ID: 950730069

View in Genome Browser
Species Human (GRCh38)
Location 3:14948539-14948561
Sequence CCCTGGCGGGGCGGGAGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950730061_950730069 -5 Left 950730061 3:14948521-14948543 CCTTATGGGGCGCGGGAGCCCTG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 950730069 3:14948539-14948561 CCCTGGCGGGGCGGGAGTAGAGG 0: 1
1: 0
2: 1
3: 32
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950730069 Original CRISPR CCCTGGCGGGGCGGGAGTAG AGG Intronic
900117023 1:1033309-1033331 CCCTGGCGGGGCGTAGGTGGGGG - Intronic
900402272 1:2477446-2477468 CCCTGGCGGGGGCGTTGTAGAGG - Intronic
900555833 1:3279864-3279886 CCCGGGGGGGGTGGGAGGAGGGG - Intronic
901237113 1:7673019-7673041 CCCCGGCCCGGCGGGAGTGGCGG + Intronic
901455689 1:9361581-9361603 CCGTGGCCGGGCGGAAGTAGGGG + Intronic
902223747 1:14983241-14983263 CCCTGCCGGGGTGGAGGTAGGGG - Intronic
903921603 1:26804039-26804061 CCCCGGCGGGGAGGGAGGTGGGG - Intergenic
904405791 1:30287180-30287202 CCCTGCAGGGGCGGGAGCATTGG - Intergenic
904471801 1:30740881-30740903 CCCTTGCAGGGCCGGAGGAGTGG - Intronic
905229857 1:36508198-36508220 GCCTGGTGGGGTGGGAGTGGTGG + Intergenic
907481477 1:54748214-54748236 CCCTGGGTGGGGGGGAGTTGAGG + Intergenic
909501579 1:76340511-76340533 CCCTGGCCAGGCAGGAGTTGAGG - Intronic
910203423 1:84723772-84723794 CCATGGTGGGGTGGGAGTAGTGG - Intergenic
910301073 1:85708182-85708204 GCCTGGCAGGGAGGGAGTAAGGG - Exonic
912799270 1:112711070-112711092 CCCTGGGGAGGGGGGAGTAGAGG + Exonic
912800824 1:112718929-112718951 CCCACGCGGGGCTGGAGGAGCGG + Intergenic
913592186 1:120340906-120340928 GCCTGGCCGGGCGGGAGGCGAGG + Intergenic
914169940 1:145214827-145214849 GCCTGGCCGGGCGGGAGGCGAGG + Intergenic
914525057 1:148458790-148458812 GCCTGGCCGGGCGGGAGGCGAGG + Intergenic
914598619 1:149177040-149177062 GCCTGGCCGGGCGGGAGGCGAGG - Intergenic
914641346 1:149608344-149608366 GCCTGGCCGGGCGGGAGGCGAGG - Intergenic
918983688 1:191596196-191596218 CTCTGGCCGGGCGGGGGCAGTGG - Intergenic
922586290 1:226737090-226737112 CCCTGGCGGGGAGAGGGTACCGG + Exonic
923012376 1:230098619-230098641 CCATAGCGGGGAGGGAGGAGTGG + Intronic
1063664740 10:8054505-8054527 CAGTGGAGGGGCGGGAGGAGGGG + Intronic
1066295634 10:34051728-34051750 CCCTTGGGGGGCAGCAGTAGGGG + Intergenic
1068026071 10:51646018-51646040 TCCTGTTGGGGTGGGAGTAGGGG + Intronic
1069557627 10:69408156-69408178 CCCTGGATGGCAGGGAGTAGGGG + Intronic
1070552508 10:77501760-77501782 CCATGGTGGGGTGGGAGCAGGGG + Intronic
1070670750 10:78375659-78375681 CGCTGGAGGGACGGGAGCAGGGG + Intergenic
1070889278 10:79930042-79930064 CCCTGTCGGGGCTGGATTTGTGG + Intergenic
1071119809 10:82264405-82264427 ATCGGGCGGGGCGGGAGTGGGGG - Intronic
1073392852 10:103193335-103193357 CCCTGGCCGGGCGCGAGCAGAGG - Intergenic
1074843224 10:117375250-117375272 CGCTGTGGGCGCGGGAGTAGGGG - Exonic
1076053031 10:127350374-127350396 CCATGGCAGGGAGGGAGTAGGGG - Intronic
1076680028 10:132167112-132167134 CCCTGGCAGGGCAGGGGCAGAGG - Intronic
1076801999 10:132835215-132835237 CCCTGGCGAGGTGGGGGGAGGGG - Intronic
1077014344 11:393235-393257 CCCTGGTGGGGGTGGGGTAGTGG - Intronic
1077217721 11:1402038-1402060 CCCTGGCGGGGCACGAGGGGTGG - Intronic
1077411931 11:2407706-2407728 CCCTGGAGCGGAGGGAGCAGAGG - Intronic
1077482748 11:2824218-2824240 CCATGGAGGGGCCAGAGTAGAGG + Intronic
1077485384 11:2836065-2836087 CCGTGGCGTGGCGGGGGTGGGGG + Intronic
1077528501 11:3083606-3083628 CCCTGGAGGGGCTGGGGAAGGGG - Intergenic
1078524533 11:12090414-12090436 ACCTGCCGGGACAGGAGTAGCGG - Intergenic
1081575403 11:44316133-44316155 CCCTGGCGGCTCTGGAGAAGTGG - Intergenic
1081705524 11:45180536-45180558 CCCGGGCGGGGCGGTGGGAGAGG - Intronic
1081870020 11:46379191-46379213 CTCTGGGGGGGCTGGAGAAGGGG - Exonic
1081872760 11:46391008-46391030 CCGTTGCGGGGCCGGAGGAGGGG + Intergenic
1083163071 11:60867521-60867543 CTCTGGTGGCGAGGGAGTAGGGG + Intergenic
1083864333 11:65445628-65445650 CCCTGGTGGGGTGGGAGGAGAGG - Intergenic
1083933926 11:65860647-65860669 CCAGGGCGGGGCGGGGGAAGAGG - Exonic
1084165611 11:67373480-67373502 GCTTGGCGGGGCGGGGGTCGGGG + Intronic
1085173491 11:74467594-74467616 CCCGGGCGGGGCAGGGGGAGGGG - Exonic
1086888099 11:92226121-92226143 CGCTGGCGGGGAGGCAGTAGAGG + Intergenic
1087092102 11:94284197-94284219 ACCTGGCTGGGCAGGAGAAGAGG + Intergenic
1089349784 11:117815826-117815848 CCCTGGCAGGGCGGGAGACCAGG - Intronic
1089796656 11:120986287-120986309 GCCGGGCGGGGCGGGAGGGGAGG + Exonic
1094798267 12:34001052-34001074 CCTTGGCAGGGGGGTAGTAGGGG - Intergenic
1096222811 12:49842692-49842714 CCCTGGCGGGCAGGCAGCAGCGG + Intronic
1096491419 12:52015025-52015047 CCCTGGCGGGGGCGGAGGCGGGG + Exonic
1097986354 12:65786791-65786813 CCCTGACTGGGTGGGAGCAGGGG - Intergenic
1099191422 12:79565225-79565247 CCACGGCGGGGCGGGGGTGGGGG - Intergenic
1100142375 12:91634224-91634246 CCACGGCGGGGTGGGGGTAGGGG - Intergenic
1101436540 12:104669216-104669238 AGCTGGCGGGGCAGGAGAAGGGG - Intronic
1103167778 12:118784946-118784968 GCCTGGCAGGGAGGGAGCAGAGG + Intergenic
1104707114 12:130955681-130955703 CTCTGGTGGGGCGGGGGCAGAGG - Intronic
1106168638 13:27270709-27270731 GCCGGGAGGGGCGGGAGCAGAGG - Exonic
1108679996 13:52771847-52771869 CACTAGAGGGGCGGGAGAAGAGG + Intergenic
1109177725 13:59176707-59176729 CCCAGCTGGGGAGGGAGTAGGGG - Intergenic
1110869574 13:80434769-80434791 GCCTGTCGGGGTGGGGGTAGGGG - Intergenic
1112752463 13:102596895-102596917 CCCTGGCAGGCCGGGATTGGTGG + Intergenic
1113340287 13:109416287-109416309 CCCTGGATGGGCGGGTGAAGAGG - Intergenic
1113614597 13:111671400-111671422 CTGTTGCGGGGCGGGGGTAGGGG + Intronic
1113620064 13:111756314-111756336 CTGTTGCGGGGCGGGGGTAGGGG + Intergenic
1118883820 14:69850445-69850467 CCATGGCGGGGCGGCAGGGGAGG - Intergenic
1118992461 14:70809109-70809131 CCCCGGCGGGGCGGCAGCGGCGG + Exonic
1120914840 14:89701793-89701815 CCCCTGCGGGGCCGGAGTGGGGG + Intergenic
1121309736 14:92929322-92929344 ACCTGGCTGGGCAGGAGTTGGGG - Intronic
1121309752 14:92929362-92929384 ACCTGGCTGGGCAGGAGTTGGGG - Intronic
1121585075 14:95057829-95057851 CCCTGGCGGGGATGGTGGAGGGG + Intergenic
1122156550 14:99753547-99753569 CCCTGCCAGGGAGGGAGTAGAGG - Intronic
1122454125 14:101836331-101836353 GGCTGGCAGGTCGGGAGTAGAGG - Intronic
1122623376 14:103072051-103072073 CCCGGGTGGGGCGGGTGTGGAGG + Intergenic
1202852584 14_GL000225v1_random:30713-30735 GCCTGGCTGGGCTGGAGCAGGGG - Intergenic
1124006667 15:25800394-25800416 CCCTGGGGAGGCAGGAGCAGGGG - Intronic
1124377063 15:29135111-29135133 CCAGGGAGGGGCGGGGGTAGGGG - Intronic
1125522896 15:40358073-40358095 CTCTGGCCTGGCGGGAGCAGAGG + Intergenic
1125651488 15:41321134-41321156 CCCTGTCGGGGAGGGAGGTGGGG + Intronic
1125955969 15:43791520-43791542 CCCTGGAGGGCCGGGCGTGGTGG - Intronic
1129270224 15:74415693-74415715 CCCTGGTGTGGCAGGAGCAGGGG - Intronic
1129504426 15:76069529-76069551 CCCTGGTGGGCCGGGTGTGGTGG + Intronic
1131054804 15:89368891-89368913 CCCGGTCGGGGCTGGCGTAGAGG - Intergenic
1132378393 15:101348134-101348156 CCCCGGGGGGGCGGGGGTTGTGG - Intronic
1132549709 16:549299-549321 CCCTGGCGGTGCTGGCGGAGCGG + Exonic
1132692750 16:1188920-1188942 CCCTGGCGGGCCAGGAGGTGTGG - Intronic
1132721865 16:1320574-1320596 GCCTGGCAGGACGGGAGTGGAGG + Intronic
1133062462 16:3183620-3183642 CCCTGGCGGGGTGGGGGTCTCGG - Intergenic
1133063193 16:3188615-3188637 CCCTGGCGGGGTGGGGGTCTCGG + Intergenic
1138273836 16:55716604-55716626 TCCTGGCGGGGCGGGGGCGGGGG + Intergenic
1138360800 16:56425578-56425600 CGCTGGCGGGACGGGCGCAGGGG + Intergenic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1140939499 16:79708158-79708180 CCCTGGCGGTGTGGGAGGAAGGG + Intergenic
1141954435 16:87360975-87360997 CTGTGGTGGGGTGGGAGTAGGGG - Intronic
1142205273 16:88779923-88779945 CCCAGGCTGGGTGGGGGTAGGGG - Intronic
1142890773 17:2941034-2941056 CCCTGGCAGGGTGTGGGTAGTGG + Intronic
1142968761 17:3597221-3597243 CCCTGGCATGGCTGGAGGAGGGG - Intergenic
1145241625 17:21243685-21243707 TCCTGGCGGGGTGGGGGTGGAGG + Intronic
1146475974 17:33163076-33163098 TTCTGGTGGGGTGGGAGTAGGGG + Intronic
1147150268 17:38510188-38510210 CCCCGGCGGCGCCGGAGGAGCGG + Exonic
1147156477 17:38546764-38546786 TCCTGGCGGGGGAGGAGCAGAGG - Intronic
1147327093 17:39674836-39674858 CCCTGGCTGGGTGGGGGTAGAGG - Intronic
1147598236 17:41730449-41730471 TCCTGGTAGGGCGCGAGTAGAGG + Intronic
1148071160 17:44909616-44909638 CTCGGGCGGGGCGGGGGGAGGGG - Intronic
1148581908 17:48750029-48750051 GGCTGGCGGGGCAGGAGTTGGGG + Intergenic
1150010245 17:61496408-61496430 CCCTGGGGGGGCGATATTAGGGG + Intergenic
1150231167 17:63551296-63551318 CCCGGGGGGGGTGGGAGTAGGGG - Intronic
1151314061 17:73311230-73311252 GGTTCGCGGGGCGGGAGTAGGGG + Intronic
1151338834 17:73456802-73456824 GCCTGCCGGGGCGGGACAAGGGG + Intronic
1152111923 17:78361232-78361254 CACTGGCGGGGAGGGGGTAGAGG + Intergenic
1152226399 17:79094765-79094787 CCCTGACGGGGTGGGGGGAGGGG + Intronic
1152702076 17:81824169-81824191 CCCTGGAGGGGCAGGGGCAGGGG + Intronic
1152904530 17:82963025-82963047 CCCTGGCGGGGCGCAGGGAGAGG + Intronic
1154180070 18:12128987-12129009 ACCTGGCGGGGTGGAAGTTGCGG + Intronic
1156500167 18:37552487-37552509 GCCTGCTGGGGCGGGAGTTGGGG - Intronic
1157482815 18:48066347-48066369 CCCTGGGGGGGCGGAGGTGGGGG + Intronic
1157776833 18:50402582-50402604 ACCTGGAGGGGCTGGAGTATCGG - Intergenic
1160757467 19:765149-765171 CCCTGGGGAGGCGGGGGAAGGGG + Intergenic
1160758403 19:770453-770475 CCCTGGCGGGGCGAGGGCCGCGG - Intergenic
1160894636 19:1396729-1396751 CCCTCCTGGGGCGGGAGGAGGGG + Intergenic
1161211343 19:3067688-3067710 CCCTGGCATGGAGTGAGTAGAGG - Intergenic
1161275095 19:3411605-3411627 CACTGGAGGGCCGGGAGTGGTGG - Intronic
1162335056 19:10055174-10055196 ACCTGGCGGGCAGGGACTAGAGG - Intergenic
1162373959 19:10294329-10294351 CCCAGGCGGGTAGGGAGCAGGGG + Intronic
1162374463 19:10296511-10296533 CGCTGGCGGGGCGGCAGGCGCGG + Exonic
1162581865 19:11536217-11536239 CCCTGGCGGCCCGGGAGGGGCGG - Intergenic
1162589064 19:11578847-11578869 CCGTCGCGGGGCGGGCGTTGCGG + Exonic
1163427076 19:17245679-17245701 CCGTGGCGGGGGGGGAGGGGCGG + Exonic
1164684685 19:30158958-30158980 CCCTCCCTGGGTGGGAGTAGGGG + Intergenic
1165244930 19:34493392-34493414 CCCTGGCAGGTCTGGAGCAGGGG - Intronic
1165307808 19:35013075-35013097 CCCTGGAGGGGCTGTAGCAGGGG + Intronic
1165311368 19:35030905-35030927 CACTGGCGGGGCGGCGGGAGTGG + Intronic
1165424944 19:35740407-35740429 CCCGCCCGCGGCGGGAGTAGGGG + Exonic
1165893567 19:39128719-39128741 CCCTGGAAGGGAGGGAGGAGGGG - Intronic
1166126341 19:40717278-40717300 CCCCGGCGGGGCGGCCGGAGGGG + Exonic
1166796839 19:45431389-45431411 GCCTGGAGGGCCGGGAGCAGTGG + Intronic
1167055759 19:47111206-47111228 TCCTGGTGGGGCGAGAGAAGAGG - Intronic
1168544731 19:57240854-57240876 CCCTAGCGGGGCGGGGGCTGCGG - Intronic
925375694 2:3383397-3383419 CTCGGGCGGGGCGGGGGTGGGGG - Intronic
926090001 2:10043537-10043559 CCCTCGCGGCGCGGGAGGGGCGG - Exonic
927138473 2:20114155-20114177 CCCTGATGGGGCGGGAGTGCCGG + Intergenic
927210633 2:20637032-20637054 CCTTGGCGGGGCGGGGGGGGCGG - Intronic
928407314 2:31024444-31024466 ACCTGGTGTGGCTGGAGTAGAGG - Intronic
928783281 2:34850533-34850555 CCCTGGCGGGGTGGGGGGTGGGG - Intergenic
929780064 2:44951891-44951913 GCCTGGCGGGGCTGGAGTGTAGG - Intergenic
930022085 2:47007678-47007700 CCCTGGCAGGGAGGGGGAAGAGG + Intronic
932217202 2:69974714-69974736 CCCTGGGGTGGCAGGAGTTGTGG + Intergenic
934924140 2:98369993-98370015 TCCTGGAGGGGTGGGAGTATTGG - Exonic
935592100 2:104853613-104853635 CTCTGGCGGGGCGGGGGTAAGGG + Intergenic
936507090 2:113116485-113116507 CCCAGGCGGGGCGGGGGGTGGGG + Intronic
937100533 2:119264798-119264820 CCCTGGCGGGGGGGGGGCAGGGG - Exonic
942186230 2:173427337-173427359 CCATGGCGGGGCTGGAGTTTGGG + Intergenic
944271168 2:197786179-197786201 ACCTGGCGGGTGGGGAGAAGCGG + Exonic
946310679 2:218880963-218880985 CCCTGACGGGCTGGGAGTGGGGG - Exonic
946326059 2:218985233-218985255 CCCGGGCGTGGCGGGGGTTGCGG + Exonic
948478124 2:238234412-238234434 CTCTGGCGGGGCGGGGCTGGAGG + Intergenic
948716900 2:239871012-239871034 CCCTGGGGGGGCTGAAGGAGCGG + Intergenic
1170190282 20:13638737-13638759 CCCGGGCGGGGCTAGAGGAGGGG - Intronic
1171108890 20:22462478-22462500 CCCTGGCAGTGCAGGAGTGGGGG - Intergenic
1171217331 20:23362070-23362092 CCCTGGCGGGGCTGAGGAAGGGG - Intergenic
1171459840 20:25292248-25292270 CCCTGTGGGAGCGGGAGTGGGGG + Intronic
1171780234 20:29410933-29410955 GCCTGGCTGGGCTGGAGCAGGGG + Intergenic
1171824198 20:29879197-29879219 GCCTGGCTGGGCTGGAGCAGGGG + Intergenic
1172237792 20:33389568-33389590 CCCCGTCCGGGAGGGAGTAGGGG + Intronic
1172530159 20:35625523-35625545 TCCTGGAGGGGAGGGAGTAGTGG - Intergenic
1172764811 20:37345871-37345893 CCCTGGCGGAGTGGGAGGCGGGG + Intronic
1172867884 20:38113658-38113680 GCCTGGTGGGGCGGGGTTAGGGG + Intronic
1173182536 20:40815786-40815808 CCCTGCCTGGGGGGAAGTAGGGG - Intergenic
1174485595 20:50859360-50859382 CCTTGGCGTGGAAGGAGTAGAGG + Intronic
1174487732 20:50871725-50871747 CCCTGGTGGGGTGGCAGGAGTGG + Intronic
1175975498 20:62708606-62708628 CCCGGGCGGGGCGGGGATGGCGG + Intergenic
1176068931 20:63216048-63216070 CCCTGGCGAGGCGGCAGCGGCGG + Exonic
1176215260 20:63944858-63944880 CCCTGGCAGGTGGGGAGGAGTGG + Intronic
1176230511 20:64030355-64030377 CCATGGCGGGGCAGGTGGAGGGG - Intronic
1176429662 21:6567959-6567981 CCCTGGCGGGGCGGGCATGGTGG - Intergenic
1178038909 21:28617275-28617297 ATCTGGCAGGGCTGGAGTAGAGG + Intergenic
1179437173 21:41369843-41369865 CCACGGCGGGGCGGGAGCGGGGG - Intronic
1179661585 21:42879319-42879341 ACCAGGCGGTGCGGGAGAAGCGG + Intronic
1179705056 21:43175421-43175443 CCCTGGCGGGGCGGGCATGGTGG - Intergenic
1181283296 22:21735333-21735355 TCACGGCGGGGCGGGAGAAGAGG + Intronic
1181953945 22:26574806-26574828 CCCTGGCGGGGCTGGAGTTGTGG - Intronic
1182095260 22:27621512-27621534 CCCTGGCAGGGAGTGAGTAGGGG + Intergenic
1182283749 22:29232278-29232300 CCCTGGCCGGGCTGGAGCTGTGG + Exonic
1182331182 22:29552603-29552625 CCCCGTCGGGTCGGGGGTAGGGG + Intronic
1184222631 22:43110685-43110707 CCCGGGCGGGGCGGGAGGGGCGG + Intergenic
1184404450 22:44292181-44292203 CTGTGGCGGGGCGGGGGTCGGGG + Intronic
1185038012 22:48489754-48489776 GCCTGCCGGGGCCGGAGGAGGGG - Intronic
1185420328 22:50731320-50731342 CACGGCCGGGGCGGGAGTGGGGG - Intergenic
950693775 3:14682366-14682388 CCCTGGGGGGGCTGGAGGAATGG - Intronic
950730069 3:14948539-14948561 CCCTGGCGGGGCGGGAGTAGAGG + Intronic
951717577 3:25665029-25665051 CCCTGGAGGGGCGGGACCCGAGG + Intergenic
954080918 3:48211969-48211991 CCCTGTCGGGGAGGGAGGTGGGG + Intergenic
954152259 3:48663423-48663445 CCCTCCCGAGGCGGGAGCAGAGG + Intergenic
954399194 3:50311237-50311259 CCCCGGCCGGGAGGGAGTTGGGG - Intronic
954705902 3:52480349-52480371 CCCTGGCTGGGCTGGGGTTGGGG + Intronic
955911724 3:63864352-63864374 CCCAGGAGAGGCGGGACTAGGGG + Intergenic
957681761 3:83445458-83445480 CTGTGGCGGGGTGGGGGTAGGGG - Intergenic
959583067 3:108001697-108001719 CCCTGGCAGGGCTTGAGAAGTGG - Intergenic
962998162 3:140651663-140651685 CCATGGTGGGGCGGGAGTGGTGG - Intergenic
966799486 3:183749435-183749457 TGCTGGGGGGGCGGGAGGAGTGG - Intronic
966886421 3:184380109-184380131 GCCGGGCGGGGCGGGAGGAGCGG - Exonic
966919385 3:184602056-184602078 CGCGGGCGGGGCGGGAGGGGAGG + Intronic
967857802 3:194131440-194131462 CCCTTCCGGGGCGGGGGTGGGGG + Intergenic
967858441 3:194134815-194134837 GCCCGGCGGGGCCGGAGGAGGGG + Intergenic
968361213 3:198148160-198148182 CCCTGGCAGGGAGGGCGCAGGGG + Intergenic
968625202 4:1623882-1623904 CTCTGGCGGGCGGGGAGAAGTGG + Intronic
968756126 4:2417507-2417529 CCTCGGCGGGGCGGGAGGTGCGG - Intronic
969976301 4:11105468-11105490 GCCTGTCGGGGTGGGAGGAGGGG + Intergenic
970341844 4:15115625-15115647 CCCTCGAGAGGCGGGAGAAGAGG - Intergenic
974193641 4:58540578-58540600 CCATGACGGGGAGGGAGTAGAGG + Intergenic
978443968 4:108763111-108763133 CCCCGGCGGGGGAGGAGGAGGGG - Intergenic
981528808 4:145733194-145733216 CTCCGGCGGGCCGGGAGGAGCGG - Intronic
983632843 4:169867093-169867115 CCCTAGGGTGGAGGGAGTAGCGG + Intergenic
984715167 4:182917846-182917868 AACTGGCGGGGCGGGAGGTGGGG + Intronic
986288406 5:6378242-6378264 GGCTGGCGGGGCACGAGTAGCGG + Intronic
988863875 5:35313638-35313660 CTCTGGAGGGGCAGGTGTAGAGG + Intergenic
989011373 5:36876567-36876589 CCCTGAGGGGACGGGCGTAGAGG + Intergenic
989103459 5:37840136-37840158 GCCTGGCGGTGGGGGAGGAGAGG + Intergenic
992894284 5:81233266-81233288 CCCTGGCGGGGCGGGGCCAGAGG - Intronic
993909512 5:93664111-93664133 CCCAGGCTGGGCGGGGGTGGGGG + Intronic
994102046 5:95904025-95904047 GCTTGGAGGGGCAGGAGTAGAGG - Intronic
994121334 5:96116982-96117004 GCTTGGCGGGGTGGCAGTAGTGG + Intergenic
994355400 5:98788675-98788697 CCCTGGCGGGTAGGGAGGAGTGG + Intronic
995438039 5:112159983-112160005 CCCGGGCGGGGTGGGGGTGGAGG - Intronic
995734906 5:115289422-115289444 CGCTGGGGTGGCGGGAGGAGCGG - Intronic
997226825 5:132215184-132215206 ATCTGGTGGGGTGGGAGTAGGGG + Intronic
997265231 5:132491141-132491163 TCCTGGCGGGGCGGGGGCGGGGG + Intergenic
997266095 5:132496243-132496265 CCCAGGCGGGGGGTGAGTCGGGG + Intergenic
997759806 5:136434137-136434159 TCCTGGAGCAGCGGGAGTAGGGG - Intergenic
998043210 5:138966491-138966513 CCCTCGGCGGGCGGGTGTAGGGG + Intronic
999201601 5:149820625-149820647 GCCTGGCAGGGTGGGAGGAGGGG - Intronic
1001695135 5:173664361-173664383 CCCGGGCGGGGTGGATGTAGGGG - Intergenic
1002795883 6:470890-470912 CCCTGGCGGGGCAGGGGGAGAGG - Intergenic
1003645372 6:7910129-7910151 CCGGGGCGGTGCGGGAGGAGGGG - Intronic
1005595494 6:27375017-27375039 CCCTGGAGAGGTGGGAGTGGAGG - Intronic
1005652818 6:27900220-27900242 CCGAGGCGGGGCAGGAGTATTGG - Intergenic
1005759078 6:28951089-28951111 CCCTGTTCGGGCGGGAGTGGTGG + Intergenic
1005822231 6:29607424-29607446 CCCTGGTGGTGTGGAAGTAGAGG - Intronic
1006057227 6:31394209-31394231 CCCTGGGGAGGAGGCAGTAGAGG + Intergenic
1006058637 6:31403724-31403746 CCTCGGCGGAGCGGGAGCAGTGG + Intronic
1006071066 6:31498285-31498307 CCCCGGCGGAGCGGGAGCGGCGG + Intronic
1006269511 6:32953088-32953110 CCCTCTCGGGGAGGGAGTTGGGG - Exonic
1006430644 6:33993594-33993616 CCATGGCGGGGCGGGGGTGGGGG - Intergenic
1006671438 6:35731944-35731966 GCCGGGCGCGGCGGGAGTGGGGG + Intergenic
1007257918 6:40541515-40541537 CCAGGACGGGGCGGGGGTAGAGG + Intronic
1007390445 6:41547151-41547173 CTGTGGCGCGGCGGGAGTGGGGG + Intronic
1007716830 6:43861674-43861696 TCCTGCAGGGGCGGGGGTAGAGG + Intergenic
1007736365 6:43984811-43984833 CCCTGGCGGGGCGGGGGAGTGGG - Intergenic
1011726371 6:90214346-90214368 CCTTGGCGGGGCGGGGGGAGGGG + Intronic
1017810742 6:157981832-157981854 GCCTGGCGCGGCGGGAGCGGCGG + Intergenic
1018400255 6:163414421-163414443 CCCCGGCGGGGCGGGCGACGGGG - Intronic
1018463399 6:164020391-164020413 CCCAGCTGGGGCGGGAGCAGGGG + Intergenic
1019475198 7:1241161-1241183 CCCTGGCGGGGAGGAAGGAACGG - Intergenic
1019779379 7:2930503-2930525 TCCTGGCGGGGAGGGGGTGGTGG + Intronic
1020186461 7:5962801-5962823 CCCTGACTGGGCTGGAGTGGGGG + Intronic
1020296453 7:6761973-6761995 CCCTGACTGGGCTGGAGTGGGGG - Intronic
1022499190 7:30871988-30872010 CCCTGGTGCGGCTGGAGTGGAGG + Intronic
1024652563 7:51418075-51418097 CCTTGGCTGGGAGGGAGCAGAGG + Intergenic
1024977338 7:55126018-55126040 TCCTGGCAGGGCAGGAGGAGAGG - Intronic
1025037743 7:55608719-55608741 CCTTGGCTGGGAGGGAGCAGAGG + Intergenic
1027220052 7:76208165-76208187 CCCTGGCGGGGTGGGCTTAGGGG + Intronic
1028082742 7:86598949-86598971 CCCTGGAGGTGGGGGAGTAGGGG + Intergenic
1029098789 7:98110378-98110400 CCTAGACGGGGCGGGCGTAGGGG - Intronic
1029508153 7:100975294-100975316 CCCTGGAGGGGCGGGGCCAGGGG + Intronic
1030138946 7:106285398-106285420 CCCAGGCGGGGCGGGCGAACCGG - Intronic
1030185715 7:106759788-106759810 CCATGGTGGGGAGGGAATAGTGG + Intergenic
1030819868 7:114083260-114083282 CCATGCTGGGGCGGGAGTGGTGG + Intergenic
1033340186 7:140485952-140485974 ACCTGGTGGGGCGGGGGAAGGGG + Intergenic
1033779041 7:144647820-144647842 CCCTGGAGGGGCAGGTGAAGGGG + Intronic
1034392963 7:150800552-150800574 CCCTGGCCGGGCGGGGCTGGAGG + Exonic
1034589737 7:152129069-152129091 CCCTGGCGGCGGGGGAGCTGCGG + Intergenic
1034676462 7:152895955-152895977 CCCTGGCAGGAGGGGAGGAGGGG + Intergenic
1035040056 7:155920726-155920748 CTTTGGCGGGGCGGGGGTAGGGG + Intergenic
1035051371 7:156000822-156000844 CCCTGGTGGGGCAAGAGAAGAGG - Intergenic
1035105692 7:156440269-156440291 CTCTGGCGGGGCCAGAGTGGAGG - Intergenic
1036950307 8:13133482-13133504 CCTGGGCGGGGCGGGGCTAGAGG - Intronic
1038455906 8:27671869-27671891 CCCTGGCTGGGCAGGAGGAGAGG + Exonic
1041201494 8:55454614-55454636 CCCTGGCTGGGGGCTAGTAGAGG - Intronic
1042837877 8:73093409-73093431 TGCTGGCGGGGCGGGGGTCGGGG + Intronic
1043147174 8:76673487-76673509 GGCTGGCGGGGCGGGGGGAGCGG + Intergenic
1044707813 8:95025224-95025246 CCCTGGCGCGGCGGGAAGCGGGG + Intronic
1044772082 8:95646811-95646833 CCCTGGTGGGCCGGGTGCAGTGG - Intergenic
1045268919 8:100645001-100645023 CCCTGGCTGAGATGGAGTAGAGG + Intronic
1045388178 8:101690614-101690636 TTCTGGCGGGGAGGGAGTTGTGG - Intronic
1045518998 8:102886954-102886976 CCCTGGCCTGGAGGAAGTAGGGG - Intronic
1047594701 8:126366497-126366519 GGGTGGCGGGGCGGGAGTGGCGG - Intergenic
1047752791 8:127894515-127894537 CACTGGCTGGACAGGAGTAGGGG - Intergenic
1049009704 8:139879252-139879274 CCCTGGCTGGGGGTGAGGAGTGG + Intronic
1049629833 8:143647678-143647700 CCCTTGTGGGGCCAGAGTAGGGG + Intronic
1049675708 8:143887986-143888008 CCCTCGCAGGGCTGGAGAAGTGG + Intergenic
1049773752 8:144395407-144395429 CCCTGGTGGGGTGGGGGTGGGGG + Intronic
1051199728 9:14603029-14603051 TCCTGGAGGGGTGGGAGTTGAGG + Intergenic
1053014119 9:34652155-34652177 CCCAGGGCGGGAGGGAGTAGAGG + Intronic
1054337373 9:63818333-63818355 GCCTGGCTGGGCTGGAGCAGGGG + Intergenic
1055266671 9:74500704-74500726 CCTAGGCGGGGGAGGAGTAGGGG - Intronic
1056676891 9:88683464-88683486 CCCCGGCGCCGCGGGAGGAGAGG - Intergenic
1056799540 9:89681489-89681511 CGGTGGCGGGGCGGGGGCAGCGG - Intergenic
1057006761 9:91567802-91567824 CCCTGTCGGTGCTGAAGTAGTGG - Intronic
1059061420 9:111038312-111038334 CCCCGGCGGGGTGGGCGCAGGGG - Intronic
1059398750 9:114055259-114055281 CCCTGGCTGGGCGGGAGGGAAGG - Exonic
1060855740 9:126914329-126914351 TCCTGGCGGGGCGGGGGGGGGGG - Intergenic
1061188857 9:129070434-129070456 CCCTGGGGGAGCTGCAGTAGAGG + Exonic
1061943532 9:133895287-133895309 GCCTGGCGGGGCTGGGGTCGGGG + Intronic
1062326731 9:136015952-136015974 CCCTCGCGGGGCGGGGGGACTGG + Intronic
1062412209 9:136431254-136431276 GCCTGGGGGGGCGGGCGTGGCGG - Intronic
1062412255 9:136431378-136431400 GCCTGGGGGGGCGGGCGTGGAGG - Intronic
1062412271 9:136431420-136431442 GCCTGGGGGGGCGGGCGTGGAGG - Intronic
1062412302 9:136431503-136431525 GCCTGGGGGGGCGGGCGTGGAGG - Intronic
1062412318 9:136431545-136431567 GCCTGGGGGGGCGGGCGTGGCGG - Intronic
1062412334 9:136431587-136431609 GCCTGGGGGGGCGGGCGTGGAGG - Intronic
1062412350 9:136431629-136431651 GCCTGGGGGGGCGGGCGTGGAGG - Intronic
1062412396 9:136431753-136431775 GCCTGGGGGGGCGGGCGTGGAGG - Intronic
1062459313 9:136656322-136656344 CCCTGGTGGGGAGGGAGGAGGGG - Intergenic
1062572025 9:137190175-137190197 CCCTGGCAGGGCAGGAGTGTGGG - Exonic
1062745924 9:138211992-138212014 CCCTGGCAGGGAGGGTGCAGGGG + Intergenic
1203377271 Un_KI270442v1:385642-385664 GCCTGGCTGGGCTGGAGCAGGGG + Intergenic
1187699636 X:21952865-21952887 ACCTTGCGGGGCGGGAGGGGAGG - Intronic
1189336277 X:40172576-40172598 CCCTGGCCGGACGGGTGTTGAGG + Intronic
1189767086 X:44382799-44382821 CCCTGGAGGGTAGGGAGAAGGGG + Intergenic
1191252157 X:58264891-58264913 CCCTGGAGGGCCGGGCGCAGGGG - Intergenic
1192204185 X:69085404-69085426 CCCTGGAGGGTCTGGAGCAGTGG + Intergenic
1193698502 X:84737950-84737972 CCCTGGCCTGGAGGGAGTCGGGG - Intergenic
1196456650 X:115895843-115895865 CCATGTCTGGGCGGGACTAGCGG - Intergenic
1201637550 Y:16141592-16141614 GACTGTGGGGGCGGGAGTAGGGG + Intergenic