ID: 950738929

View in Genome Browser
Species Human (GRCh38)
Location 3:15034193-15034215
Sequence GCTGGATCCGAGACTGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950738929_950738935 11 Left 950738929 3:15034193-15034215 CCTGCTTCAGTCTCGGATCCAGC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 950738935 3:15034227-15034249 CTCCTGCCCTGCAGGGTTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 398
950738929_950738931 3 Left 950738929 3:15034193-15034215 CCTGCTTCAGTCTCGGATCCAGC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 950738931 3:15034219-15034241 AAGCCTGCCTCCTGCCCTGCAGG 0: 1
1: 0
2: 9
3: 50
4: 430
950738929_950738932 4 Left 950738929 3:15034193-15034215 CCTGCTTCAGTCTCGGATCCAGC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 950738932 3:15034220-15034242 AGCCTGCCTCCTGCCCTGCAGGG 0: 1
1: 0
2: 5
3: 64
4: 491
950738929_950738936 12 Left 950738929 3:15034193-15034215 CCTGCTTCAGTCTCGGATCCAGC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 950738936 3:15034228-15034250 TCCTGCCCTGCAGGGTTGCAGGG 0: 1
1: 0
2: 2
3: 35
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950738929 Original CRISPR GCTGGATCCGAGACTGAAGC AGG (reversed) Intronic
902562838 1:17288588-17288610 GCTAGTTGGGAGACTGAAGCAGG + Intergenic
903078632 1:20791013-20791035 GCTGCTTTGGAGACTGAAGCAGG - Intergenic
903220626 1:21867635-21867657 GCTGGAGCCGAGGGTGGAGCTGG - Intronic
906978266 1:50599222-50599244 GCTGCTTCGGAGGCTGAAGCAGG - Intronic
911020156 1:93378070-93378092 GCTGCTTGGGAGACTGAAGCAGG + Intergenic
911319626 1:96396667-96396689 GCTGGAGCAGAAACTGAAGTGGG + Intergenic
911477872 1:98395853-98395875 GCTGCTTACGAGACTGAGGCAGG + Intergenic
912993389 1:114510760-114510782 GCGGGAGCCGAGGCTGGAGCTGG + Exonic
913275142 1:117130234-117130256 GCTGGAACCTAGTCTGAAGGAGG - Intergenic
914762538 1:150610748-150610770 GCTGTACCAGAGGCTGAAGCAGG - Intronic
914807025 1:150999150-150999172 GCTGGGTCCCAGAGTGAAGATGG + Intronic
915007638 1:152655086-152655108 GCTGGATCACAGACTGAATTAGG + Intergenic
917856242 1:179102417-179102439 TACGGATCCCAGACTGAAGCAGG + Exonic
917913914 1:179681187-179681209 GCTGCTTGAGAGACTGAAGCAGG - Intronic
918129166 1:181609839-181609861 GCTGGATCTGAAACTCAAGTGGG + Intronic
918296155 1:183159409-183159431 GCTGCCTGGGAGACTGAAGCAGG - Intergenic
918511385 1:185317322-185317344 GATGGATTCGAGACGGAAGCGGG - Exonic
919739119 1:200971985-200972007 CTTGGCTCCCAGACTGAAGCGGG + Intronic
920248971 1:204609692-204609714 GCAGGATTCGAGACTACAGCTGG - Intergenic
1070553584 10:77511154-77511176 GCTGAATCAGAAACTGAGGCTGG - Intronic
1073118528 10:101107477-101107499 ACTGCATCCGAGAGAGAAGCGGG + Intronic
1074012862 10:109501562-109501584 GCTGGTTCCGTGGCTGGAGCAGG + Intergenic
1075703658 10:124485310-124485332 GCTGGACCCGGGAGTGGAGCTGG + Intronic
1076269005 10:129134129-129134151 GCTGGGACTGAAACTGAAGCCGG + Intergenic
1076611332 10:131727647-131727669 GCTGGACCTGAGAATGAAGCCGG - Intergenic
1077474227 11:2778845-2778867 GCTGCAGCCGAGATGGAAGCAGG - Intronic
1077474379 11:2779453-2779475 GCTGCAGCCGAGATGGAAGCAGG - Intronic
1078421761 11:11218467-11218489 GCTGGAGCCAAGACTGCAGGAGG - Intergenic
1084769163 11:71331605-71331627 CCTGGATCCGAGGCTAAGGCAGG + Intergenic
1085524060 11:77154268-77154290 GCTGGTTCCTAGTCTGATGCAGG + Intronic
1088075026 11:105837380-105837402 GCTGGATCCAAGACCACAGCTGG + Intronic
1089642841 11:119859113-119859135 GCTGGACCAGACAGTGAAGCAGG + Intergenic
1092578726 12:9816977-9816999 GCTGGATGGGAGGCTGAGGCGGG - Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092761445 12:11814852-11814874 GCTGGATGCAAGGCAGAAGCAGG - Intronic
1096229762 12:49890330-49890352 GCTGGCACAGAGCCTGAAGCTGG - Intronic
1096539621 12:52298201-52298223 GCTGGAGCAGAGATTGAAGGAGG + Intronic
1099491161 12:83290316-83290338 GCTAGATCTGGGCCTGAAGCGGG + Intergenic
1102240926 12:111324236-111324258 GCTGCTTAGGAGACTGAAGCGGG + Intronic
1102343657 12:112143842-112143864 GCTACATCGGAGACTGAAGTGGG - Intronic
1103031060 12:117613355-117613377 GCTGGGTCTGGGACTGAGGCTGG - Intronic
1106228668 13:27804582-27804604 GCTAGTTGGGAGACTGAAGCAGG - Intergenic
1106826533 13:33528379-33528401 GCTACATCGGAGACTGAAGCTGG - Intergenic
1107164892 13:37272422-37272444 GCTGGCTCCCAGGCTGAGGCAGG + Intergenic
1107840384 13:44451233-44451255 GCTGCAACCGTGACAGAAGCGGG + Intronic
1109370606 13:61415624-61415646 GCTGGATCCGAGGCTCCAGGAGG - Intronic
1112569549 13:100581286-100581308 GCTGAACCTAAGACTGAAGCAGG + Intronic
1112909476 13:104463531-104463553 CCTTGATCCAAGCCTGAAGCTGG + Intergenic
1113364847 13:109666494-109666516 GCTGGATGGGAGACTGGAGGGGG - Intergenic
1113895221 13:113759892-113759914 CCTGGCTCCGAGGCTGCAGCGGG - Intronic
1118752661 14:68817966-68817988 GCTGGATCCTGGACTGCAGGAGG - Intergenic
1118752691 14:68818135-68818157 GCTGGAGCTGAGACTGGGGCGGG - Intergenic
1121928545 14:97950924-97950946 GCCAGCTCAGAGACTGAAGCAGG + Intronic
1122479843 14:102039947-102039969 GCTACTTCGGAGACTGAAGCAGG - Intronic
1128031956 15:64488987-64489009 GCTACATGGGAGACTGAAGCAGG + Intronic
1128094582 15:64944110-64944132 GCAGGATCAGATCCTGAAGCTGG + Intronic
1129388416 15:75208251-75208273 GCTGGATCCCGGGCTGAAGCTGG - Exonic
1133726471 16:8542212-8542234 GGTGGAACAGAGTCTGAAGCAGG - Intergenic
1135741171 16:24976415-24976437 GCTGCTTGGGAGACTGAAGCAGG + Intronic
1137618754 16:49862099-49862121 GCTAGTTGGGAGACTGAAGCAGG - Intergenic
1139364948 16:66427370-66427392 GCTGGAGCCGAAGCTGGAGCCGG + Exonic
1139448715 16:67014201-67014223 GCTGGATCCGTGACTGCAGTTGG - Intergenic
1141836973 16:86547352-86547374 GCTGGATACGGGACTGAAAATGG - Intronic
1142839887 17:2619888-2619910 GCTACATAGGAGACTGAAGCAGG - Intronic
1144945701 17:18968510-18968532 GCTGGGTCTCAGGCTGAAGCTGG - Intronic
1145274905 17:21423443-21423465 GCTGGGAACAAGACTGAAGCTGG - Intergenic
1146410929 17:32584123-32584145 TCTGGATACGAGAATGAAGATGG - Intronic
1147678852 17:42226350-42226372 GCTGGATTCTGGACTGCAGCGGG + Intronic
1148863093 17:50614722-50614744 GCTCCATCCCAGACTCAAGCTGG - Intronic
1149627197 17:58088261-58088283 TCTTGAGCCGAGATTGAAGCTGG + Intronic
1150559684 17:66283791-66283813 GCTGCTTGGGAGACTGAAGCAGG - Intergenic
1150920529 17:69477538-69477560 GCTGCATCGGGGACTGAAGTGGG + Intronic
1151580103 17:74972707-74972729 GCTGGAGCCGGAGCTGAAGCCGG - Exonic
1151776917 17:76210914-76210936 GCTGCTCCAGAGACTGAAGCAGG - Intronic
1152201175 17:78947299-78947321 GCTGGAGCCGAGTCCAAAGCCGG - Intergenic
1154086114 18:11307171-11307193 GCTGCATGGGAGACTGAGGCAGG - Intergenic
1157970566 18:52263067-52263089 GCTGGTTGGGAGACTGAAGCAGG - Intergenic
1158475791 18:57778335-57778357 GCTGCTCCCGAGACTGAGGCAGG - Intronic
1160072874 18:75643587-75643609 GATGGAGCAGAGACTGAAGGAGG - Intergenic
1162079938 19:8211778-8211800 GCTGCATGGGAGACTGAGGCAGG + Intronic
1162934768 19:13976440-13976462 GCCCGAGCCGGGACTGAAGCGGG + Intronic
1162985221 19:14265487-14265509 GCAGGAACCGAGAGTTAAGCAGG - Intergenic
1163310503 19:16511508-16511530 GCAAGAGCCGAGACTGAAGCTGG - Intronic
1163853664 19:19682329-19682351 GATGCTTCGGAGACTGAAGCAGG - Exonic
1163856315 19:19704957-19704979 GCTGAATCCGGAACTGAGGCTGG + Intergenic
1164538847 19:29107052-29107074 GCTGTTTGGGAGACTGAAGCGGG + Intergenic
1166810282 19:45510003-45510025 GCTGTGTCCGGGACTGGAGCTGG + Intronic
1167441356 19:49511039-49511061 GCTGGTTCAGAGTCTGATGCGGG - Intronic
931367466 2:61631302-61631324 GCTATTCCCGAGACTGAAGCAGG - Intergenic
932575635 2:72960999-72961021 GCTGGAACCGTGAATGAGGCTGG - Intronic
932611947 2:73206448-73206470 GCTGCTTGGGAGACTGAAGCAGG - Intronic
932750866 2:74370902-74370924 GCTGGAAACTAGACTGGAGCTGG - Intronic
933991128 2:87634687-87634709 GCTGGATCCCAAACTAGAGCAGG - Intergenic
935898437 2:107763513-107763535 GCTGTTTGGGAGACTGAAGCAGG + Intergenic
936302711 2:111316136-111316158 GCTGGATCCCAAACTAGAGCAGG + Intergenic
938801886 2:134771307-134771329 GCTGGTGCCTAGTCTGAAGCAGG + Intergenic
939084799 2:137707104-137707126 GCTACATGCAAGACTGAAGCTGG + Intergenic
942277926 2:174336249-174336271 GCTGGAGCCGAGGTTGCAGCTGG - Exonic
942479973 2:176374913-176374935 GCTGGTTCCAAGTCTGAAGAAGG - Intergenic
943432098 2:187816944-187816966 CCTGCACCCGAGGCTGAAGCAGG - Intergenic
945429196 2:209745026-209745048 GCTGCTTGAGAGACTGAAGCAGG - Intergenic
945804840 2:214478120-214478142 CCTGGCTGCCAGACTGAAGCTGG - Intronic
948841045 2:240649088-240649110 GCTGGATTCAGGACTGAAGGAGG + Intergenic
948923653 2:241080510-241080532 GGTGATTCCAAGACTGAAGCAGG + Intronic
1168922184 20:1548844-1548866 GCTGGACCGGAGACTGAAAAAGG - Intronic
1171447841 20:25217351-25217373 GCTGGCTGCGAGACAGGAGCAGG - Intronic
1172910341 20:38404321-38404343 CCTGGATCCCAGAATGAAGAGGG - Intergenic
1173495312 20:43514131-43514153 GCTGGACCTGAGACGGAAGTGGG + Intronic
1173636453 20:44562936-44562958 GCTGCTTGGGAGACTGAAGCAGG + Intronic
1178982984 21:37280949-37280971 GCTGCTTGGGAGACTGAAGCAGG - Intergenic
1181474018 22:23157765-23157787 CCTGGATCCCACACTGAGGCTGG + Intronic
1182018365 22:27060185-27060207 CCTGGATCCCAGGCTGAAGGTGG - Intergenic
1184161783 22:42701349-42701371 GCTGGATCCCAGACTCAGACAGG + Intronic
1184373411 22:44097048-44097070 GGTGGCTCCAAGACTGAGGCAGG - Intronic
1184973488 22:48044564-48044586 GCTGCATCTGAGGCTGAGGCTGG - Intergenic
1185340837 22:50290395-50290417 GCTGGATGCGAAGCTGCAGCTGG - Exonic
950738929 3:15034193-15034215 GCTGGATCCGAGACTGAAGCAGG - Intronic
950783033 3:15408908-15408930 GCAGCATCTGAGGCTGAAGCTGG + Intronic
954664774 3:52245925-52245947 GCTGGAGCCGCGAAGGAAGCGGG - Intronic
960822484 3:121749488-121749510 GCCGGATCCAGGACTGAATCCGG + Intronic
961426079 3:126849285-126849307 GCTGGCTCCAAGTCTGGAGCAGG - Intronic
961430419 3:126878333-126878355 GCTGGTTCCGAGGCTGCAACAGG + Intronic
961997048 3:131257095-131257117 GCTGCATGAGAGGCTGAAGCGGG - Intronic
965837819 3:172870500-172870522 GCTGGATCCGAAAATGAAATGGG - Intergenic
971572598 4:28232081-28232103 GCTACATGGGAGACTGAAGCAGG + Intergenic
979545305 4:121933230-121933252 GCTAGATCCCAGAAGGAAGCCGG + Intronic
983634622 4:169884598-169884620 GCTGGAGCTGACACTGAAGTGGG - Intergenic
987035385 5:14013768-14013790 GCTACTTCGGAGACTGAAGCAGG - Intergenic
987390150 5:17367964-17367986 CCTGGAACTGAGACCGAAGCTGG - Intergenic
987394558 5:17410041-17410063 GCTAGCTCTAAGACTGAAGCAGG - Intergenic
988158332 5:27484689-27484711 GCTACTTCGGAGACTGAAGCAGG - Intergenic
992639576 5:78757510-78757532 GCTGGTTTCCAGCCTGAAGCTGG + Intronic
993885722 5:93412733-93412755 GCTGGATCCCAGCCTACAGCTGG - Intergenic
997953895 5:138263649-138263671 CCTGGATCCCAGAATGAAGAAGG + Intronic
1001124964 5:169011112-169011134 GCTGGACTGGAGGCTGAAGCAGG - Intronic
1002151140 5:177232009-177232031 GCTACATGTGAGACTGAAGCAGG - Intronic
1002555054 5:180030617-180030639 GCTACATCGGAGACTGAGGCAGG - Intronic
1002756944 6:171300-171322 GCTGGTTGGGAGACTGAGGCAGG + Intergenic
1005505059 6:26462433-26462455 GCTAGTTGGGAGACTGAAGCAGG + Intronic
1006429469 6:33986089-33986111 GCTGGAACCGAGAGAGAGGCTGG - Intergenic
1007814316 6:44509697-44509719 GCTGCTTGGGAGACTGAAGCAGG + Intergenic
1013418395 6:109944968-109944990 GCTGGATCATAGAATGTAGCAGG + Intergenic
1015398129 6:132758154-132758176 GCTGTTTCAGAGACTGAAGAAGG - Intronic
1015732489 6:136362645-136362667 GCTGGGGCCGAGGCTGGAGCTGG + Exonic
1015732495 6:136362663-136362685 GCTGGGGCCGAGGCTGGAGCTGG + Exonic
1016376435 6:143425552-143425574 GCTGGACCCTAGACTGGACCTGG + Intronic
1016412138 6:143794680-143794702 GCTGCTTGGGAGACTGAAGCAGG + Intronic
1019564780 7:1673914-1673936 GCTGGAACCCAGGCTGAGGCAGG + Intergenic
1022403686 7:30065940-30065962 GCTGAATCAGACACTGAGGCTGG + Intronic
1022721170 7:32942937-32942959 GCTGGATCAGGAACTGCAGCGGG - Intergenic
1023594014 7:41810048-41810070 GTTAGAGCCCAGACTGAAGCCGG + Intergenic
1023932980 7:44717835-44717857 GCTGTTCCCGAGGCTGAAGCAGG + Intergenic
1024285841 7:47756781-47756803 TCTGGGACAGAGACTGAAGCTGG - Intronic
1026169023 7:67936664-67936686 CCTGTATCCCAGGCTGAAGCAGG + Intergenic
1029204684 7:98862608-98862630 GCTGTATAAGAGGCTGAAGCAGG - Intronic
1030708077 7:112715767-112715789 GCTGGAACCGATTCTCAAGCAGG + Intergenic
1033901252 7:146143872-146143894 GCTACATGGGAGACTGAAGCAGG - Intronic
1034318836 7:150160705-150160727 GCAGGAGCTTAGACTGAAGCTGG + Intergenic
1034773921 7:153806500-153806522 GCAGGAGCTTAGACTGAAGCTGG - Intergenic
1036432860 8:8705952-8705974 CGTGGATCCCAGACTGATGCAGG - Intergenic
1036673121 8:10806267-10806289 GTTGGATCCAAGCCTGAAGAAGG - Intronic
1036793619 8:11740101-11740123 GTTGTATCTGAGCCTGAAGCCGG + Intronic
1038740731 8:30214417-30214439 GCTACATGGGAGACTGAAGCAGG - Intergenic
1039598369 8:38811355-38811377 GCTGGATACAGGACTGAAGTAGG - Intronic
1041375094 8:57204562-57204584 GCAGGAACCGAGACTGTCGCAGG - Intergenic
1047602627 8:126441447-126441469 GCTGCATGCAAGAGTGAAGCTGG + Intergenic
1047963483 8:130028010-130028032 GCTGGAGCTGGGGCTGAAGCTGG - Intergenic
1050412839 9:5384078-5384100 GATGGATCTGAGACTCAGGCAGG + Intronic
1055104320 9:72496932-72496954 GCTACATGGGAGACTGAAGCAGG - Intergenic
1056214855 9:84397503-84397525 GCCGGATCAGAGGCAGAAGCTGG + Intergenic
1056777595 9:89525092-89525114 GCTGCAGCCGAGACTGAGGCCGG - Intergenic
1061289456 9:129642334-129642356 GCCAGATCCGAGACTCAGGCGGG + Intergenic
1187933166 X:24312111-24312133 CCTGGGTCAGAGACTGATGCTGG - Intergenic
1187939058 X:24363943-24363965 CCTGGGTCAGAGACTGATGCTGG + Intergenic
1191762820 X:64663260-64663282 GCTGGATCAGAAGCTGATGCTGG - Intergenic
1198576094 X:138011799-138011821 GCAGGACCCCAGACTGTAGCTGG + Intergenic
1199097189 X:143757451-143757473 GCTTGATCGGAGTCTGAATCCGG - Intergenic