ID: 950742752

View in Genome Browser
Species Human (GRCh38)
Location 3:15063364-15063386
Sequence CCCAGCAGGTACCCAAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950742744_950742752 11 Left 950742744 3:15063330-15063352 CCTCAAATACTAAATAAGGCACC 0: 1
1: 0
2: 5
3: 125
4: 476
Right 950742752 3:15063364-15063386 CCCAGCAGGTACCCAAAGACTGG 0: 1
1: 0
2: 1
3: 21
4: 169
950742743_950742752 12 Left 950742743 3:15063329-15063351 CCCTCAAATACTAAATAAGGCAC 0: 1
1: 0
2: 0
3: 4
4: 141
Right 950742752 3:15063364-15063386 CCCAGCAGGTACCCAAAGACTGG 0: 1
1: 0
2: 1
3: 21
4: 169
950742746_950742752 -10 Left 950742746 3:15063351-15063373 CCTTCCCATTGCCCCCAGCAGGT 0: 1
1: 0
2: 1
3: 33
4: 305
Right 950742752 3:15063364-15063386 CCCAGCAGGTACCCAAAGACTGG 0: 1
1: 0
2: 1
3: 21
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950742752 Original CRISPR CCCAGCAGGTACCCAAAGAC TGG Intronic
900469861 1:2848415-2848437 CCCAGGAGGTACCCAGAGAGGGG + Intergenic
901149214 1:7089292-7089314 CCGTGCTGGTACCCAAAGCCAGG + Intronic
901614674 1:10529043-10529065 CAAAGCAGTTACCCAAAGAGGGG - Intronic
902751121 1:18511793-18511815 CCCCGCAGGTACAGAAAGCCAGG + Intergenic
903968407 1:27103465-27103487 CCCAGCACTTATCTAAAGACAGG + Intronic
904031001 1:27533372-27533394 CCCAAGAGGTCCCCAAAGTCAGG + Intergenic
904781682 1:32954379-32954401 CAGACCAGGTACCCAAAAACAGG - Intronic
904992403 1:34603743-34603765 CCCAGCATGGAGCCAAAAACTGG - Intergenic
910008904 1:82436235-82436257 CCCACCTCCTACCCAAAGACTGG - Intergenic
912723100 1:112036345-112036367 ACCAGCAGGTACCCACAGGCAGG + Intergenic
914394031 1:147247719-147247741 CTCTGCTGATACCCAAAGACAGG - Intronic
915679270 1:157564558-157564580 CCCAGCATGTATCCTAAGATGGG - Intergenic
916724618 1:167511705-167511727 ACCATCATATACCCAAAGACTGG - Intronic
919083302 1:192891650-192891672 CCCAGCAGGCACCCACAGGAGGG + Intergenic
920389978 1:205593545-205593567 CCCAGCAGTTATCCACAGCCTGG + Intronic
1064782368 10:18856671-18856693 CCCAGCAGGTACCCCGAGTCCGG + Intergenic
1065073215 10:22049190-22049212 CCCAGCCCCTACCCAAAAACTGG + Intergenic
1065966958 10:30778553-30778575 CACAGCAGGCACACAAACACAGG - Intergenic
1067851630 10:49758545-49758567 CGCAGCCTGTACCCCAAGACGGG + Exonic
1070743237 10:78916367-78916389 GCCAGCAGGTCCCCGCAGACAGG - Intergenic
1070804023 10:79260144-79260166 CACTGCAGGTACACAAAGCCTGG - Intronic
1070919976 10:80178466-80178488 GCCAGAAGGTCCCCAGAGACAGG - Intronic
1071447505 10:85762470-85762492 CCCAGCTGGCACCCCCAGACAGG - Intronic
1071950432 10:90697341-90697363 GCCAGCACATCCCCAAAGACTGG - Intergenic
1075467248 10:122660993-122661015 CCCAGCAGGTACCCAGCAACTGG - Intergenic
1078522940 11:12077846-12077868 CCCTGCAGGTTCCCTAACACTGG - Intergenic
1080408530 11:32001412-32001434 CCTAGCAGGTACTCAAAAAATGG + Intronic
1080665233 11:34330113-34330135 CCCAGCAGGGACCAGAAGTCAGG - Intronic
1080866721 11:36202016-36202038 CCCAGGAAGTACCCAAGGAGGGG - Intronic
1085346779 11:75773277-75773299 CCCTGGAGGTACCCACAGTCTGG + Intronic
1088507741 11:110542498-110542520 CCAAGCAGGAACCCAAGGAGAGG - Intergenic
1091075720 11:132614197-132614219 TCCAGCAGGTACCAAAGCACAGG - Intronic
1094653445 12:32399456-32399478 GCCAGCAGGTCCCCAAGGGCGGG - Intergenic
1096556269 12:52406030-52406052 CCCAGTCGGTACCCGAAGCCAGG + Exonic
1099048929 12:77759931-77759953 TGCAGCAGATACCCAAAGAGTGG + Intergenic
1100281297 12:93120677-93120699 TGTAGCAGGTACCCAAAGGCTGG - Intergenic
1101732226 12:107436304-107436326 CCCAGAAGGAACACAGAGACCGG - Intronic
1102547515 12:113667377-113667399 CCCAGCAAGTGCTCAAAGAATGG + Intergenic
1104078011 12:125407514-125407536 CCCAGCAGGGACAGACAGACAGG - Intronic
1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1111195373 13:84869689-84869711 CCCAGCAGGTATCCCAAGTCTGG - Intergenic
1114084532 14:19229776-19229798 CCCACCAGGTACCACAGGACAGG - Intergenic
1114594677 14:23901129-23901151 CCCAGCTGGCATCCAAAGAATGG + Intergenic
1115812319 14:37123254-37123276 CACAGCAGGTACACCAAGCCTGG - Intronic
1115889554 14:38011573-38011595 CCCGGCAGGTTCCCCAAGTCCGG - Intronic
1117545441 14:56791167-56791189 CCCTGCAGGCACCAAAACACAGG + Intergenic
1122613945 14:103004085-103004107 CCCAGGAGGGACCCCGAGACCGG - Intronic
1122935394 14:104953649-104953671 CCAAGCAAGCACACAAAGACAGG - Exonic
1126176139 15:45737665-45737687 CTAAGGAGGTACCCACAGACAGG - Intergenic
1127106310 15:55620328-55620350 CTCATCAGGTCCCCACAGACAGG + Intronic
1127358174 15:58221723-58221745 CCCAGCTGGCATCCAAAGACAGG + Intronic
1129104604 15:73297556-73297578 CCCAGCTAGTACACAAAGATTGG + Intronic
1129670929 15:77607368-77607390 CCCAGCAGGGACCCAAGGTCTGG - Intergenic
1129973721 15:79803561-79803583 CCCACCAGATACAGAAAGACGGG + Intergenic
1130322176 15:82850499-82850521 ACAAGCAGGTTCCCAAAGACAGG + Intronic
1130577887 15:85108407-85108429 CCCAGCAGGTGCACAGAGAAGGG + Intronic
1135198350 16:20413835-20413857 CCCAACACCCACCCAAAGACTGG + Intronic
1135219879 16:20604723-20604745 CCCAACACCCACCCAAAGACTGG - Intergenic
1135413228 16:22250589-22250611 CCCAAAAGGGACCCTAAGACAGG - Intronic
1136298223 16:29315889-29315911 CCTAGCAGTTACAGAAAGACTGG + Intergenic
1137398473 16:48133994-48134016 CCCAGCAGGTACTCACAGCTCGG + Intronic
1138331348 16:56218353-56218375 CCCTGCAAGAACCAAAAGACTGG - Intronic
1138529817 16:57628795-57628817 GGCAGCAGGTACCCAAACAAGGG + Intronic
1142059870 16:88022393-88022415 CCTAGCAGTTACGGAAAGACTGG + Intronic
1142755196 17:2012303-2012325 GCCAGCAGGCACGGAAAGACTGG - Intronic
1143002167 17:3801260-3801282 ACCAGCAAGGACCCACAGACCGG + Intergenic
1143016030 17:3891846-3891868 CCCAGGAGGCCCCCAAAGCCAGG + Intronic
1146123610 17:30215650-30215672 GCCAGCAGGACCCCAAAGCCCGG + Exonic
1147211613 17:38875321-38875343 CCCACCAGGGACACTAAGACAGG - Intronic
1147587290 17:41659797-41659819 CCCAGCAGGTACCCAGAGCCAGG + Intergenic
1148772197 17:50073997-50074019 CCCAGCAGGTACAGAGAGACGGG + Exonic
1149337006 17:55645558-55645580 CCAAGCAGTTTCCCAAAGCCAGG - Intergenic
1151978689 17:77496916-77496938 CCCAGCAGGGGCCTGAAGACAGG - Intronic
1152592071 17:81218650-81218672 CCAAGCAGGTTCCCAAAGCCTGG - Intronic
1153388469 18:4527644-4527666 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1154139727 18:11812367-11812389 CCCTGCAGGTTCCCAAGTACAGG - Intronic
1161302410 19:3549002-3549024 CCCAGCTGGTGCCCAAAGCCAGG - Intronic
1161816120 19:6501256-6501278 CCCAGCAGGGAGCCAGAGGCTGG - Intronic
1162364155 19:10237891-10237913 CCCAGCAGGTAGGAACAGACAGG + Intergenic
1163099725 19:15087480-15087502 CCCAGCAGCAGCCCACAGACAGG - Exonic
1164217483 19:23162369-23162391 CCCAGCAGGTTCCCTAACAGGGG - Intergenic
1166041483 19:40205384-40205406 CCCTGCATGGACCCAAAGGCTGG - Intronic
1166343795 19:42153043-42153065 ACCCGCAGGGACCCAAAGGCGGG - Intronic
1166715138 19:44962027-44962049 CCCAGCCGGCACCCAATGCCTGG + Exonic
1167272345 19:48512613-48512635 CACAGCAGCTACACAGAGACAGG + Intronic
1167463747 19:49639664-49639686 CCCAGGAGGTGCTCAAAGCCAGG + Intronic
925739373 2:6992391-6992413 CACAGCAGAGACCCAGAGACGGG + Intronic
931716446 2:65032682-65032704 CCCAGGAGGGACCCACACACAGG - Intergenic
931717076 2:65037753-65037775 CCCAGCTGGAATCCAAACACTGG + Intergenic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933362355 2:81304456-81304478 CCCAGCTGGTACCCCAAGTCCGG + Intergenic
935935921 2:108182903-108182925 CCCAGCAAATAACCTAAGACTGG + Intergenic
936342462 2:111646462-111646484 CTCAGCAGAAACACAAAGACTGG + Intergenic
942830989 2:180237390-180237412 CCCAGCGGGTACCCGGAGTCTGG - Intergenic
943833208 2:192487900-192487922 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
945036929 2:205711883-205711905 CCCAGCAGGGCACCAAAGGCTGG - Intronic
945256638 2:207808607-207808629 CTCAGGAGGTACTCAAAGGCTGG + Intergenic
1170613972 20:17934633-17934655 CTCAGCAGTTTCCCAAAGATCGG - Intergenic
1172240959 20:33412281-33412303 GCCACCAGGTACCCACAGGCAGG - Exonic
1174095870 20:48089110-48089132 CCCAGCAGGTTCACACAGATGGG - Intergenic
1174103285 20:48143747-48143769 ACCGGCAGGTGCCCAAAGAGGGG - Intergenic
1174526482 20:51176031-51176053 CCCAGCAGGTGCACATACACTGG - Intergenic
1175610514 20:60347451-60347473 CCCTGCAGGGACCCAGAGAAGGG + Intergenic
1176030698 20:63009823-63009845 CCCTGGGGGTGCCCAAAGACCGG + Intergenic
1179309689 21:40184774-40184796 CCCAGGAGTTTCCCAAAGGCAGG - Intronic
1180029080 21:45190573-45190595 CACAGCCAGTACACAAAGACTGG - Intronic
1180293439 22:10863426-10863448 CCCACCAGGTACCACAGGACAGG + Intergenic
1180496244 22:15892841-15892863 CCCACCAGGTACCACAGGACAGG + Intergenic
1180901217 22:19374718-19374740 GCCAGCAGGTGCCCAATGAAAGG - Intronic
1181182260 22:21076697-21076719 CACAGCAGGTGCCAAAGGACTGG - Intergenic
1183178614 22:36243469-36243491 CCCAGCACCAACCCAAAGGCTGG - Intergenic
1184057216 22:42060586-42060608 TCCAGCAGGTGCCCAAGCACGGG + Intronic
1185056284 22:48580119-48580141 CCGAGCAGCTGCTCAAAGACAGG - Intronic
949908124 3:8876064-8876086 TCCAGCTGCTATCCAAAGACTGG + Intronic
950193143 3:10992030-10992052 CCCAGCTGGTACCCAGAGCCTGG + Intergenic
950742752 3:15063364-15063386 CCCAGCAGGTACCCAAAGACTGG + Intronic
951993240 3:28699388-28699410 CCCAGAAAGTTCCCAGAGACGGG + Intergenic
952716403 3:36484801-36484823 CCCAGCAGGGACACAGAGGCAGG - Intronic
953280411 3:41548765-41548787 CCATCCAGGGACCCAAAGACAGG + Intronic
954706094 3:52481260-52481282 CCCAGCAGGGACAGGAAGACTGG + Intronic
956086489 3:65616526-65616548 CACAGTAGGTACCCAAAAGCTGG + Intronic
960420120 3:117435130-117435152 CCCAGCATGTACCCAAAGCATGG + Intergenic
962267397 3:133953710-133953732 CCCAGCAGGTACCCGAAAGCCGG + Exonic
962412109 3:135150346-135150368 CCCAGTGGGTCCACAAAGACAGG - Intronic
962419866 3:135218485-135218507 GCCAGCATGTACCCAGGGACTGG + Intronic
962521619 3:136202176-136202198 CCCATCAAATACCCACAGACTGG - Intergenic
962680573 3:137795663-137795685 CCCAGCAGATAGTAAAAGACTGG - Intergenic
962954079 3:140248118-140248140 TCCATCAGATACCCACAGACAGG - Intronic
963260144 3:143184181-143184203 TCCAGCAGGGACCAAAAGACTGG - Intergenic
966679927 3:182631194-182631216 CCAAGCAGGCTCCCAAAGCCAGG + Intergenic
969860083 4:10028775-10028797 TCCAGCAGGTTCCCTAGGACAGG - Intronic
974354119 4:60790031-60790053 CCCAGCAGCTGACCCAAGACTGG + Intergenic
978491902 4:109318775-109318797 CTCAGCAAGAACCCAAAGAATGG + Intergenic
979126607 4:116980760-116980782 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
980292101 4:130856993-130857015 ACCAGCAGCTAGCCAAAGAGTGG + Intergenic
983327431 4:166274578-166274600 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
983348496 4:166557965-166557987 CCTAGGAGTTACCCAAAGAAGGG - Intergenic
984462683 4:180057970-180057992 CACACCAGTTACCCAAAGGCCGG - Intergenic
985771516 5:1814846-1814868 CCCAGGAGGAACCCACAGAGCGG - Intronic
986115469 5:4769517-4769539 ACCAGCAGCTACTCCAAGACTGG - Intergenic
987829564 5:23077694-23077716 CCCAGCAGAAACCCCAAGAGAGG - Intergenic
989175496 5:38521483-38521505 CACTGCCGGGACCCAAAGACTGG - Intronic
991011260 5:61885122-61885144 TCCATCAGTGACCCAAAGACTGG - Intergenic
992081286 5:73235601-73235623 CCTAGCAGGGACCCAACCACTGG - Intergenic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
996502058 5:124228490-124228512 CCCAGAAGTTAGCCAAAGAATGG - Intergenic
998039981 5:138945732-138945754 GGCAGCAGGTACCCAATGGCTGG + Intergenic
999301275 5:150492066-150492088 CCCAGCAGGGACCTGAACACAGG - Intronic
999759091 5:154686571-154686593 CCCACCAGGTAGCAATAGACTGG + Intergenic
1002540503 5:179903367-179903389 CCCAGCAGGTACCCGCTGAAAGG + Intronic
1003383507 6:5646616-5646638 CCCAGCAGATACCAAAATCCAGG + Intronic
1004109030 6:12696563-12696585 CCCTGCAGGTACCAAAATCCAGG + Intergenic
1004264191 6:14134529-14134551 CCCAGGAGCTACCCCAGGACTGG + Intronic
1004835016 6:19521008-19521030 CCCAGCAGGGACCCAATGCAAGG + Intergenic
1006082403 6:31575048-31575070 CCCCGCAGGGACCCAAACACAGG + Intergenic
1007252024 6:40502278-40502300 CCCAGCCGGCACCCAGAGCCAGG + Intronic
1008485187 6:52027828-52027850 CCCAGCAGGGACCCACAGCAAGG + Exonic
1012247773 6:96945357-96945379 CCCAGCCTGTACCCTAAGACTGG + Intronic
1013705768 6:112832309-112832331 CCCAACAGGTACCTGAAGAAAGG + Intergenic
1014792700 6:125692930-125692952 CCCAGCAGCAACCCAGAGCCTGG - Intergenic
1014869208 6:126570808-126570830 CCCAGAAGGTATCAAAACACAGG + Intergenic
1016119364 6:140328180-140328202 CCCTGCTGGAACCCAAAGAATGG - Intergenic
1016161260 6:140883439-140883461 CACAGCCCATACCCAAAGACAGG + Intergenic
1018055205 6:160046383-160046405 CCCAGGAGGTTCCCAACGGCAGG - Intronic
1018364242 6:163101704-163101726 CTCAGCAGGTACACGAAGAAAGG - Intronic
1019427729 7:985255-985277 CCCAGCAGGGACACAAACACGGG - Exonic
1020244044 7:6416971-6416993 CCCAGCAGAGACTCAAAGATGGG + Intronic
1020939216 7:14509780-14509802 CCCAGCAGGTACCCCGAGTCTGG - Intronic
1024109654 7:46132369-46132391 CCCTGCAGGTGCCCAGAAACAGG + Intergenic
1024634527 7:51276338-51276360 CCCAGAAGGAACCCCAGGACAGG - Intronic
1025077295 7:55954004-55954026 CCCTGCTTGAACCCAAAGACAGG + Intronic
1026233376 7:68505061-68505083 CCCAGCAGGGAGAGAAAGACAGG - Intergenic
1027522047 7:79221406-79221428 CACAGCAGGAAACCAGAGACAGG + Intronic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1029406129 7:100374903-100374925 CCCAGCAGGTGCCCAGTGGCTGG + Intronic
1032388022 7:131538037-131538059 CACATCAGTTTCCCAAAGACAGG - Intronic
1033638531 7:143237626-143237648 CCTACCAGGGAACCAAAGACTGG - Intergenic
1033670728 7:143489958-143489980 ACCAGCAGGTAACCAATGCCTGG - Intergenic
1034367168 7:150561096-150561118 ACCTGCGGGTACCCAAAGTCTGG + Intergenic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1045420859 8:102013602-102013624 CCAAGCAGGTAGCCAGAGAAGGG - Intronic
1047220715 8:122916201-122916223 CCCAGCAAGGCTCCAAAGACTGG + Intronic
1051156251 9:14150130-14150152 CCAAGCAGGTACTGAAAGAAGGG - Exonic
1053135803 9:35649759-35649781 CCCAACCAGCACCCAAAGACGGG - Exonic
1055321274 9:75085809-75085831 CCCAGCATTTACCCAAACACTGG - Intronic
1057953169 9:99386006-99386028 CCCAGCAGGGAGCCAGAGCCTGG - Intergenic
1058781922 9:108346250-108346272 CCCAGCACCTACCTAAAGGCTGG - Intergenic
1061895732 9:133646406-133646428 CCCAGCCGGTACTCAGAGCCTGG + Intronic
1062488413 9:136792329-136792351 CCGGGCAGCTCCCCAAAGACAGG + Exonic
1192640116 X:72853772-72853794 CCAAGCTGGTATGCAAAGACTGG + Intergenic
1192641595 X:72867033-72867055 CCAAGCTGGTATGCAAAGACTGG - Intergenic
1195819264 X:108925666-108925688 CAAAGCTGGTCCCCAAAGACGGG + Intergenic