ID: 950748800

View in Genome Browser
Species Human (GRCh38)
Location 3:15112487-15112509
Sequence ACCGGCTTTAAGGGTAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950748791_950748800 29 Left 950748791 3:15112435-15112457 CCAAATTGATCCAAAGCTGCTCA No data
Right 950748800 3:15112487-15112509 ACCGGCTTTAAGGGTAAACCAGG No data
950748793_950748800 19 Left 950748793 3:15112445-15112467 CCAAAGCTGCTCACATGGAAATG No data
Right 950748800 3:15112487-15112509 ACCGGCTTTAAGGGTAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950748800 Original CRISPR ACCGGCTTTAAGGGTAAACC AGG Intergenic
No off target data available for this crispr