ID: 950751858

View in Genome Browser
Species Human (GRCh38)
Location 3:15135441-15135463
Sequence TTGGGATGTTAGGATGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950751856_950751858 -10 Left 950751856 3:15135428-15135450 CCACTGTTTGATGTTGGGATGTT No data
Right 950751858 3:15135441-15135463 TTGGGATGTTAGGATGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950751858 Original CRISPR TTGGGATGTTAGGATGCTGC AGG Intergenic
No off target data available for this crispr