ID: 950752883

View in Genome Browser
Species Human (GRCh38)
Location 3:15144834-15144856
Sequence CTGTGTTTAAGGTGAGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950752877_950752883 11 Left 950752877 3:15144800-15144822 CCCAAGGTTTGGAACGATGGGAA No data
Right 950752883 3:15144834-15144856 CTGTGTTTAAGGTGAGAAGCGGG No data
950752876_950752883 12 Left 950752876 3:15144799-15144821 CCCCAAGGTTTGGAACGATGGGA No data
Right 950752883 3:15144834-15144856 CTGTGTTTAAGGTGAGAAGCGGG No data
950752878_950752883 10 Left 950752878 3:15144801-15144823 CCAAGGTTTGGAACGATGGGAAG No data
Right 950752883 3:15144834-15144856 CTGTGTTTAAGGTGAGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950752883 Original CRISPR CTGTGTTTAAGGTGAGAAGC GGG Intergenic
No off target data available for this crispr