ID: 950755751

View in Genome Browser
Species Human (GRCh38)
Location 3:15170778-15170800
Sequence TGATCGTCAAAGAACATCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950755750_950755751 -10 Left 950755750 3:15170765-15170787 CCTTTATTTGGCATGATCGTCAA No data
Right 950755751 3:15170778-15170800 TGATCGTCAAAGAACATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950755751 Original CRISPR TGATCGTCAAAGAACATCAC AGG Intergenic
No off target data available for this crispr