ID: 950758430

View in Genome Browser
Species Human (GRCh38)
Location 3:15197996-15198018
Sequence AAACCCTGCTTCATAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950758429_950758430 10 Left 950758429 3:15197963-15197985 CCATAATCTCATTATGGTTTCTC No data
Right 950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG No data
950758427_950758430 20 Left 950758427 3:15197953-15197975 CCAGTCTACTCCATAATCTCATT No data
Right 950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950758430 Original CRISPR AAACCCTGCTTCATAAAGAT AGG Intergenic