ID: 950761768

View in Genome Browser
Species Human (GRCh38)
Location 3:15236180-15236202
Sequence TTGTGAAAGGGGAAGAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 591}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950761764_950761768 -2 Left 950761764 3:15236159-15236181 CCTGTCTGAAAAAATAAAAAATT 0: 2
1: 24
2: 563
3: 3441
4: 27234
Right 950761768 3:15236180-15236202 TTGTGAAAGGGGAAGAAAATAGG 0: 1
1: 0
2: 6
3: 69
4: 591
950761761_950761768 28 Left 950761761 3:15236129-15236151 CCACTGTGCTTCAGCCTGAGTGA 0: 2
1: 113
2: 2012
3: 19481
4: 122427
Right 950761768 3:15236180-15236202 TTGTGAAAGGGGAAGAAAATAGG 0: 1
1: 0
2: 6
3: 69
4: 591
950761763_950761768 -1 Left 950761763 3:15236158-15236180 CCCTGTCTGAAAAAATAAAAAAT 0: 4
1: 158
2: 1396
3: 22578
4: 44840
Right 950761768 3:15236180-15236202 TTGTGAAAGGGGAAGAAAATAGG 0: 1
1: 0
2: 6
3: 69
4: 591
950761762_950761768 14 Left 950761762 3:15236143-15236165 CCTGAGTGATAGAGACCCTGTCT 0: 1
1: 35
2: 364
3: 979
4: 1704
Right 950761768 3:15236180-15236202 TTGTGAAAGGGGAAGAAAATAGG 0: 1
1: 0
2: 6
3: 69
4: 591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950761768 Original CRISPR TTGTGAAAGGGGAAGAAAAT AGG Intronic
900577834 1:3392893-3392915 TGATAAAAGGGGGAGAAAATAGG + Intronic
900765315 1:4501074-4501096 TTGTGGAAAGGGAAGAAAGGAGG - Intergenic
901542668 1:9930615-9930637 TTGTGCAGAGGGAAGGAAATTGG - Intronic
903585224 1:24410010-24410032 ATTTCAAAGGGGAAAAAAATTGG + Intronic
904347940 1:29885697-29885719 TTGTAAAAAGGAAAGAAAACGGG + Intergenic
905003526 1:34692590-34692612 TTTTAAAAGGCAAAGAAAATGGG + Intergenic
905254613 1:36672228-36672250 TGGGAAATGGGGAAGAAAATGGG - Intergenic
905591579 1:39168431-39168453 TAGTGAAGTGGGAAGAACATGGG + Intronic
906217665 1:44053247-44053269 TTGTAAAAAGGAAGGAAAATGGG + Intergenic
906726692 1:48049336-48049358 TTCTGAAATGGGCAGAAGATGGG + Intergenic
907403773 1:54241378-54241400 GTGTGAAAGGGAAAGAAACGGGG + Intronic
908171117 1:61505490-61505512 TGGGGGAAGGGGAAGGAAATGGG + Intergenic
908716715 1:67078558-67078580 ATGTGTGAGGGGAAGACAATAGG + Intergenic
908763228 1:67531360-67531382 TGGTGGAAGGGGAAGCAAACAGG + Intergenic
909968131 1:81943849-81943871 TATGAAAAGGGGAAGAAAATAGG - Intronic
910144669 1:84065591-84065613 TTGTGAAATGGGAATATAACAGG + Intergenic
910210710 1:84789681-84789703 CAGTGATAGGGTAAGAAAATAGG - Intergenic
911034408 1:93525307-93525329 TTTTAAAAGGGAAAGAAAACAGG - Intronic
911251106 1:95577237-95577259 TGGGGAAAAGGGAAGAGAATAGG - Intergenic
911507262 1:98768441-98768463 AGGTGAAAGGAGAAGAAAGTTGG + Intergenic
911846105 1:102752807-102752829 TAGTGAAAGGGAGAAAAAATAGG + Intergenic
912128270 1:106568369-106568391 TGTTGAAATGGGAAGAAAAGTGG - Intergenic
912157643 1:106941875-106941897 GTGGGAAAGAGGAAGAAAGTGGG + Intergenic
912451748 1:109771735-109771757 TTGTCAAAGGGTAAGAACAGTGG + Intronic
912867586 1:113271786-113271808 ATGTGAAGGAGGAAGAAGATGGG - Intergenic
913033020 1:114931763-114931785 TTGAGAAAGTAGAACAAAATTGG + Intronic
913365975 1:118039347-118039369 TTGTGAAAAAGGAAGAGAAAGGG - Exonic
913448487 1:118975047-118975069 TTGTGAATGGAGAAGGGAATGGG + Intronic
913484739 1:119323692-119323714 TTGAGAAAGTGGACCAAAATTGG + Intergenic
914892308 1:151637103-151637125 TGGTAAAATGGAAAGAAAATGGG - Intronic
914993662 1:152520058-152520080 TTGAGAAAGAGGAAGCAACTGGG + Intronic
915494648 1:156273167-156273189 TGGTGGAAGGGGAAGATAAATGG - Intronic
915532691 1:156512278-156512300 GAGAGAAATGGGAAGAAAATAGG - Intergenic
915730381 1:158049653-158049675 TGGTGACAGGGGAAGCAATTAGG + Intronic
915815366 1:158959947-158959969 TGGTGAAAGGGCAGGAAACTTGG + Intronic
916244509 1:162673915-162673937 GTGTAAAAAGGGAAGAAAAAGGG - Intronic
916363731 1:163999944-163999966 TTGGGACAAAGGAAGAAAATTGG - Intergenic
917291997 1:173479671-173479693 TTGAAAATGGGTAAGAAAATGGG + Intronic
917597975 1:176548816-176548838 TTGTAAATGGGGATGAAAATGGG + Intronic
917651333 1:177080739-177080761 TAGTGAAGGGGAAAGAGAATGGG + Intronic
918127984 1:181601085-181601107 TTGCCATAGGGGATGAAAATAGG + Intronic
918545030 1:185672616-185672638 TCTTAAAAGGGGAAGAACATAGG - Intergenic
919269316 1:195318576-195318598 ATTTGAAAGTGAAAGAAAATAGG - Intergenic
919868825 1:201804755-201804777 TTGTAACAGGGGAAGATAGTAGG - Intronic
920862016 1:209717553-209717575 TTATCAAAGAGAAAGAAAATTGG + Intronic
921607984 1:217177521-217177543 ATGAGAAAGAGAAAGAAAATGGG - Intergenic
922317031 1:224451697-224451719 TTGGCCCAGGGGAAGAAAATAGG + Intronic
924373486 1:243382006-243382028 TTCTGAAAGTGGAAGAAAGTGGG + Intronic
1063281485 10:4633992-4634014 TAAGGAAATGGGAAGAAAATAGG + Intergenic
1063818214 10:9801878-9801900 TTAAGAAAGGGGAACTAAATAGG - Intergenic
1064383477 10:14868077-14868099 TTTTGAAAGAGGGAAAAAATAGG + Intronic
1064749583 10:18513192-18513214 TTGTGACGTGGGACGAAAATTGG - Intronic
1064900221 10:20287944-20287966 GTGTGAAAAGAGAAGAAATTGGG + Exonic
1065147685 10:22787741-22787763 TTGAGAATGGTGAAGCAAATGGG - Intergenic
1065974595 10:30831102-30831124 CTGTGAAAGAGAAAGAAAACTGG - Intronic
1066541305 10:36449625-36449647 GTGTGAAAGGAGATGCAAATAGG + Intergenic
1066553291 10:36583216-36583238 CTGTGAAGAGGGAAGAAAATTGG - Intergenic
1068324007 10:55460058-55460080 TTGTGGAATGTGAAGAAAACAGG + Intronic
1068336528 10:55639531-55639553 TTTTGAAAGGGGAAGAAACTGGG + Intergenic
1068339362 10:55681911-55681933 TGGTGGAAGGGGAATCAAATCGG - Intergenic
1069119742 10:64555295-64555317 CTGTGAAAGAGAAAGAAATTGGG - Intergenic
1070025121 10:72625165-72625187 TTGATAAATAGGAAGAAAATGGG + Intronic
1070442985 10:76464879-76464901 ATGTGACACGGGAAGACAATAGG + Intronic
1070456933 10:76626718-76626740 TTGAGAAATGGCAAGAAGATTGG - Intergenic
1070458119 10:76638052-76638074 TTGTTCAAGGGGAGGAAAAGTGG + Intergenic
1070860992 10:79661440-79661462 TTGTTAGTGGGGAAAAAAATAGG - Intergenic
1070876269 10:79814145-79814167 TTGTTAGTGGGGAAAAAAATAGG + Intergenic
1071044844 10:81361287-81361309 TTGGTAAAAGGGAAGAAAAGGGG - Intergenic
1071201157 10:83221756-83221778 TTGTGATGGGGAGAGAAAATGGG + Intergenic
1071307642 10:84313341-84313363 TTGTAAATGGGGAAAAAATTAGG - Intergenic
1071513962 10:86284846-86284868 GTGGTATAGGGGAAGAAAATTGG + Intronic
1071643199 10:87336318-87336340 TTGTTAGTGGGGAAAAAAATGGG + Intergenic
1072181350 10:92984092-92984114 TTGTGTAAAGGGAACAATATGGG - Intronic
1072547546 10:96451285-96451307 TGTTGAGAGCGGAAGAAAATTGG - Intronic
1072888181 10:99298625-99298647 TTGTAAAAAGTAAAGAAAATGGG + Intergenic
1073475675 10:103751438-103751460 TTGTTAAATGGGAAGAATAATGG - Intronic
1073628331 10:105122004-105122026 ATGTGGAAGGGAAGGAAAATGGG - Intronic
1075996562 10:126881707-126881729 ATATGTAAGGGAAAGAAAATTGG + Intergenic
1076056423 10:127377583-127377605 TTTTTTAAGGGCAAGAAAATAGG - Intronic
1076545425 10:131242358-131242380 ATGTGTAAGAGAAAGAAAATGGG + Intronic
1077806716 11:5597605-5597627 TAGTGAAAGTGGAATAAAATAGG - Intronic
1077933128 11:6754096-6754118 TTGTAAAAAGGAAGGAAAATGGG - Intergenic
1079188783 11:18260490-18260512 TTTTGTAATGGGAAGGAAATAGG - Intergenic
1079295673 11:19231404-19231426 TGGTGAAATGGGAAGAACAATGG - Intronic
1079393636 11:20043309-20043331 TTGTTCAAGTGGCAGAAAATAGG + Intronic
1079431596 11:20394964-20394986 TTGTGTAATGGGAAGAACGTGGG + Intronic
1079573581 11:21975306-21975328 TTATTAAAGGGGAAGAACTTGGG + Intergenic
1079602183 11:22323434-22323456 TTGTGATAAGGGATGAAAACAGG + Intergenic
1079703916 11:23588967-23588989 TTGTGAAGGAGGAAGAAGAGGGG + Intergenic
1079936826 11:26627179-26627201 TTTTGAAAGGGGAAGACACCAGG + Intronic
1079949107 11:26779823-26779845 TTTAGAATGGGGAAGAAAATGGG - Intergenic
1080172520 11:29322360-29322382 TTATTAAAAGGGAAAAAAATAGG + Intergenic
1080278576 11:30530629-30530651 TTGAAAAATGGGAAGAAACTGGG + Intronic
1080665083 11:34328778-34328800 TTCTGAAATGGAAAGCAAATTGG + Intronic
1080831253 11:35895225-35895247 TTGTCAAAGAGGATGAATATGGG - Intergenic
1080941239 11:36921231-36921253 TGGTGAAAAGGGAAAAAAGTGGG + Intergenic
1081557884 11:44183692-44183714 TAGTCAAAGATGAAGAAAATAGG - Intronic
1082634937 11:55583926-55583948 ATGTGAAAGGGGCAGAAGATTGG - Intergenic
1083482858 11:62960885-62960907 TCTGGAAAGGGGAAAAAAATTGG - Intronic
1084020085 11:66412092-66412114 TGGTGGAAGGGGAAGAAAGGAGG + Intergenic
1084259413 11:67965783-67965805 TTGTAAAAGAGGAACAAAGTTGG - Intergenic
1085231926 11:74979558-74979580 TGAGGAGAGGGGAAGAAAATAGG + Intergenic
1085995733 11:81910963-81910985 TTTAGAAAGTGGTAGAAAATTGG + Intergenic
1086561731 11:88176263-88176285 TTGTAAAATAGGAAGAAAAATGG - Intergenic
1086761209 11:90633948-90633970 TGGTGGAAGGGGAAGCAAAGAGG + Intergenic
1087038376 11:93775421-93775443 TAGTAAAAGAGGGAGAAAATAGG - Intronic
1087160255 11:94941678-94941700 TTCTGAAAGGGGAAAACACTGGG - Intergenic
1087542577 11:99539588-99539610 ATGTGAAAAGGAAAGATAATTGG - Intronic
1087729854 11:101766843-101766865 TTGTGTAAGCAGATGAAAATAGG + Intronic
1088086338 11:105985118-105985140 GTGTGAATGAGGAAGAAAAGAGG - Intergenic
1088900364 11:114111398-114111420 ATGTGAAAGAGAAAGAAAAGGGG - Intronic
1089503285 11:118945613-118945635 TTCTGAAAGAGGAAGAAATTGGG - Intronic
1089672516 11:120066261-120066283 TTTTCACAGAGGAAGAAAATAGG - Intergenic
1089807178 11:121101121-121101143 TTTTCAAAGGGGAAAAAAAAAGG + Intergenic
1090961680 11:131562870-131562892 TGGTTAAAGGGGCAGGAAATGGG - Intronic
1091081724 11:132675990-132676012 TTGTAAAAGGAGAAAAAAGTTGG + Intronic
1091351452 11:134900538-134900560 TTGTGAAAATCAAAGAAAATCGG - Intergenic
1091474140 12:754452-754474 TTTTGAAAGGGGCTGAAATTAGG + Intronic
1091485338 12:881261-881283 TTGTGAAAGGACAAGAATAATGG - Intronic
1091578143 12:1758901-1758923 TTTTGAAAGTAGACGAAAATAGG + Intronic
1091964695 12:4728797-4728819 TTGAGAAAGAAGAAGAAAGTTGG - Intronic
1092327665 12:7550559-7550581 TGGTGAGAGAGGAAGAAAACAGG - Intergenic
1093107669 12:15109046-15109068 TTTTGAAAGGGGAACAGAAGGGG + Exonic
1093662075 12:21768413-21768435 TGATGAAAGGGGAAGAAACAAGG - Intronic
1093784559 12:23177211-23177233 TTGGGGAAGGGGAGGAAAGTAGG - Intergenic
1094846771 12:34364787-34364809 TTGTGGAAGGAAAAGAAAAAGGG - Intergenic
1094848436 12:34371688-34371710 TTGTGGAAGGAAAAGAAAAACGG - Intergenic
1095241462 12:39864626-39864648 ATGTAAGAAGGGAAGAAAATGGG - Intronic
1095282842 12:40376272-40376294 TTATTTAAGGGGAAAAAAATAGG + Intergenic
1095878371 12:47106417-47106439 TTGCGTAATGGGAAGAAAAGTGG + Intronic
1096904025 12:54916596-54916618 TGGTGAGAGTGTAAGAAAATGGG - Intergenic
1096907936 12:54952933-54952955 TTGTGTTTGGGGAAGAAAAATGG - Intronic
1098298072 12:69024379-69024401 TTGTGAAAGGGAGACATAATTGG - Intergenic
1098477503 12:70921700-70921722 TGGTGCAAGTGGAGGAAAATGGG - Intergenic
1098514910 12:71364025-71364047 AGGTGAAAGGGGTAGAAAAAAGG + Intronic
1098631955 12:72734220-72734242 GAGTGAAAGGGAAAGAAAGTAGG - Intergenic
1098698228 12:73586751-73586773 GTTAGAAAGGAGAAGAAAATGGG + Intergenic
1099967217 12:89461420-89461442 TTGTGAAGGGTGAAGGAATTTGG + Intronic
1100364176 12:93904157-93904179 TTGGGAAGTGGGAAGAAAATTGG - Intergenic
1101033339 12:100681131-100681153 TTGAGAAAGAGAAAGAAAAATGG + Intergenic
1101489111 12:105195743-105195765 TGATGAGAGGGAAAGAAAATGGG + Intronic
1103602289 12:122061898-122061920 TCTTGAAAGGGGAAAAAATTAGG - Exonic
1103909785 12:124345860-124345882 TTGTGAAGGGGAAGGAGAATGGG - Intronic
1104400428 12:128471553-128471575 TTGCTAAAGGGGATTAAAATGGG + Intronic
1105022978 12:132829305-132829327 TTTTTAAAGGGGAAGCAAATAGG - Intronic
1105564692 13:21533011-21533033 TCTTGAAAGGGAAAGAAAAGAGG + Intronic
1105721664 13:23122473-23122495 TTGTGAAAGAGAAAGACAAGGGG + Intergenic
1106303508 13:28490499-28490521 TTGAGGGAGGGGAAGGAAATTGG - Intronic
1106358780 13:29010656-29010678 TTGTGATAGAGCAAGTAAATAGG - Intronic
1106408033 13:29490844-29490866 TCCTGGGAGGGGAAGAAAATAGG + Intronic
1106616151 13:31329815-31329837 TTTTGACAGAGGAAGAAAAGGGG + Exonic
1107328735 13:39273941-39273963 TTCTGAAAGGGGAAGAATGAAGG + Intergenic
1107892102 13:44922902-44922924 TTGTAAAATGGGAAGAATATTGG - Intergenic
1108327370 13:49347528-49347550 ATAGGAAAGGGGAAAAAAATGGG + Intronic
1108642291 13:52394310-52394332 TTTTGAAAAGGCAAGAATATTGG + Intronic
1108726243 13:53184553-53184575 TGGTGGAAGGGGAAGCAAACAGG + Intergenic
1108897385 13:55350288-55350310 TGGTGTAATGGGGAGAAAATTGG + Intergenic
1108937276 13:55898794-55898816 TTGGGAAAAGGGAAGATAAAGGG - Intergenic
1109110183 13:58307596-58307618 TGGTAAAAGGAGGAGAAAATAGG - Intergenic
1109142977 13:58738779-58738801 TTCAGACAGGGAAAGAAAATTGG - Intergenic
1109808607 13:67476979-67477001 TTGTGAAAGAGGAATGAATTTGG + Intergenic
1109990525 13:70048882-70048904 CTTTGAAAGGGGCAGAAAGTAGG + Intronic
1110773061 13:79372547-79372569 TTTTGAAAGAGGAATAAAATTGG - Intronic
1111057257 13:82967737-82967759 TTATGAAAAAGGAAGAATATTGG + Intergenic
1111649858 13:91075856-91075878 TTGTGAAGAAGGAACAAAATGGG - Intergenic
1111787753 13:92812035-92812057 TTGAAAAAGAGGAATAAAATTGG - Intronic
1111826037 13:93268964-93268986 CTTTAAAAGGGGAAGAAAAGAGG - Intronic
1112808496 13:103189101-103189123 TTGGGAAAGGCCAAGAGAATGGG + Intergenic
1112930035 13:104723162-104723184 TTGTTAAAGGGAAAGAAATTTGG - Intergenic
1113077562 13:106482524-106482546 AAGTGAAAGAGGAAGGAAATTGG + Intergenic
1114585262 14:23806329-23806351 TTTGGGAAGGGGAAGAAAAATGG - Intergenic
1114893229 14:26952174-26952196 TTGGTCAATGGGAAGAAAATAGG + Intergenic
1114930646 14:27463539-27463561 TTATGAAAGGAGAAATAAATCGG + Intergenic
1116050254 14:39794160-39794182 TGGTGGAAGGGGAAGCAAACAGG + Intergenic
1116290181 14:43024426-43024448 GTGGGAAAGGGGAAGGAAATCGG + Intergenic
1116310929 14:43326393-43326415 GTGGGAGAGGGGGAGAAAATGGG + Intergenic
1116530599 14:45968061-45968083 TTGGCAGAGTGGAAGAAAATGGG - Intergenic
1116683840 14:48012405-48012427 AAGTGAATGGGGAAGAAAGTAGG + Intergenic
1117361425 14:54978899-54978921 TTCTGGAAAGGGAAAAAAATAGG - Intronic
1117370024 14:55069629-55069651 TTGTCAAAAAGGAAGAAAAAAGG + Exonic
1117661388 14:58009260-58009282 TTCTTAAAGGGGAAGAATAAAGG - Intronic
1117825661 14:59700425-59700447 TTGAGAAAGAAGAACAAAATTGG + Intronic
1119137604 14:72234910-72234932 GTGGGAAAGGGGAAGAAAAGAGG + Intronic
1120034480 14:79681013-79681035 TTGGGAAAGGGAAGGAAAATTGG - Intronic
1120297006 14:82654498-82654520 TTGTAAATGGGGAAGTATATTGG + Intergenic
1120667140 14:87319708-87319730 TAGTAAAAGGGGAAAAAAATTGG - Intergenic
1121275702 14:92666241-92666263 GCTTGAAAGGGGAATAAAATAGG + Intronic
1121329046 14:93038487-93038509 TTTTGGAAGGGAAAGAAAAGTGG + Intronic
1121590014 14:95097640-95097662 TTGTGAAGGGGGAAGACGAAGGG + Intronic
1121761043 14:96445357-96445379 CTGAGAAATGGGTAGAAAATAGG + Intronic
1124012285 15:25848659-25848681 CTGTAAAAGTGGAAGAAAAGCGG - Intronic
1124149278 15:27162631-27162653 TTGGAATAGGGAAAGAAAATGGG + Intronic
1124352293 15:28965416-28965438 TTGAAAAAGGAGAATAAAATTGG - Intronic
1124592360 15:31064465-31064487 TTCTGGAATGGGAAGGAAATGGG + Intronic
1125356612 15:38823032-38823054 TGATGAAAGGGGAAGCAAACAGG - Intergenic
1125412168 15:39416832-39416854 CTATGAAAGGGGAAGAACACAGG - Intergenic
1126143639 15:45456923-45456945 TTGTGAAAGTTGGAGAAAAGAGG + Intergenic
1126379989 15:48036663-48036685 AATTGAAAGGGAAAGAAAATCGG - Intergenic
1127040159 15:54966359-54966381 TTGTGGATGGGGAAGAGAATTGG - Intergenic
1127304667 15:57693166-57693188 GTGTTAAAGGGAAGGAAAATAGG + Intronic
1127988099 15:64090711-64090733 TTGCAAAAGGGGAAGCAAGTAGG + Intronic
1128822258 15:70669109-70669131 TTCTTTAAGGGCAAGAAAATGGG + Exonic
1130528263 15:84725402-84725424 TTGTGATAGGGGAAGAATGAAGG - Intergenic
1130760329 15:86813017-86813039 TTGTCCAAGAGGAAGAAAGTGGG + Intronic
1131082248 15:89546454-89546476 TTGTGAAAGGAGAAGAAAAAGGG - Intergenic
1132065707 15:98728980-98729002 TTGTGAGAGGTAAAGAAAAGGGG + Intronic
1133047682 16:3098103-3098125 TGGGGGAGGGGGAAGAAAATGGG + Intronic
1133168142 16:3963601-3963623 TTGTGGTTGGGGAAGGAAATGGG + Exonic
1133289686 16:4711416-4711438 TTTTAAAAGGAGAAAAAAATTGG + Intronic
1133851476 16:9508334-9508356 TCTTGCAAGGGGAAGAAATTGGG - Intergenic
1135077616 16:19407642-19407664 GGGTGAAAAGGGAAGAAAAGGGG + Intergenic
1137755601 16:50899676-50899698 TAGTGGAAGAGGAAGAAGATGGG - Intergenic
1137853753 16:51773000-51773022 TTGGAAAAGAGGAAGAAAAAGGG + Intergenic
1138263377 16:55641691-55641713 CTGTAAAAGGGGAAGATACTGGG + Intergenic
1138289444 16:55834171-55834193 TTGTGAAAGGAGAAAATAATAGG + Intergenic
1138872880 16:60913232-60913254 TGGAGAAAAGGGAAGAAAAAAGG + Intergenic
1138946959 16:61863310-61863332 ATGTGGAAGGGGAGAAAAATGGG - Intronic
1139312742 16:66041018-66041040 TTGTGGAAGGAGAAGAGAAGGGG - Intergenic
1140688419 16:77456274-77456296 TTGTGAATTTGAAAGAAAATAGG + Intergenic
1141326095 16:83060855-83060877 TTGTTTAAGGGGAAGTAAAGAGG - Intronic
1143513452 17:7408034-7408056 GTGGGGAAGGGGAAGGAAATGGG - Intronic
1143769235 17:9157497-9157519 TTTTGATGGGGGAAGAAAATAGG + Intronic
1144796706 17:17896328-17896350 TTATGAGTGGGGAAGAGAATTGG + Intronic
1145016041 17:19398868-19398890 TTGTGATAGGGAGAGCAAATGGG + Intergenic
1145821789 17:27842820-27842842 TTGTTAAAGGGAAAGTAAAATGG + Intronic
1145849270 17:28075785-28075807 TTGAGGAAGGGGGAAAAAATGGG - Intronic
1146557959 17:33842849-33842871 TTGTGAAAGAGGAATTAGATGGG + Intronic
1146560575 17:33865331-33865353 TTGTGAAAAAGGAAGGAAACAGG - Intronic
1146727014 17:35164653-35164675 ATGTTTAAGGGGAAGAAATTAGG + Intronic
1147975355 17:44244747-44244769 CTGTGGAGGGGGAAGAACATAGG + Intergenic
1148278605 17:46329467-46329489 GTGAGAAAGGGGAAGAAACATGG - Intronic
1148286054 17:46392903-46392925 TTTTGAAAGGGGAAGAAAAAGGG - Intergenic
1148300815 17:46547329-46547351 GTGAGAAAGGGGAAGAAACATGG - Intronic
1148308221 17:46610493-46610515 TTTTGAAAGGGGAAGAAAAAGGG - Intronic
1149407505 17:56368803-56368825 TTATGAAACTGGAATAAAATGGG - Intronic
1150401688 17:64861934-64861956 GTGAGAAAGGGGAAGAAACATGG + Intronic
1153121748 18:1737146-1737168 TAGTTAAAGGGACAGAAAATTGG - Intergenic
1153159224 18:2184056-2184078 TTGGGAAATGGGAATAAAATAGG + Intergenic
1153796884 18:8631683-8631705 TTTTGTAAGGGGAAGAAATATGG + Intronic
1154282770 18:13021222-13021244 TTGTGAAAGAAAAAGAAAAAAGG + Intronic
1155043903 18:22087427-22087449 GAGTGAAATGGGAAGAAAAAAGG - Intergenic
1155331284 18:24720583-24720605 ATGTGAAATGGCAAGTAAATTGG - Intergenic
1156781188 18:40852853-40852875 TTGTAAAAAGGGAAGAGAAAAGG - Intergenic
1157008031 18:43609987-43610009 TTGTTAAAGGGGAATTGAATTGG - Intergenic
1157265099 18:46211930-46211952 TTGGTCAAGGGGAAAAAAATAGG - Intronic
1157461487 18:47900126-47900148 TTTAAAAAGGGAAAGAAAATAGG + Intronic
1157745551 18:50132080-50132102 TTGGGAAGAGGGAAGAAAACAGG - Intronic
1159001650 18:62980242-62980264 CTGGGACAGGGGAGGAAAATGGG - Exonic
1159872825 18:73777666-73777688 AGGGGAAAGAGGAAGAAAATGGG + Intergenic
1160264156 18:77324426-77324448 TTGTGTAAGAGGAAGAACTTGGG + Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1162873771 19:13605752-13605774 CTGTGAAATGGGAAGAAGAATGG - Intronic
1167691399 19:50985812-50985834 TTGCCACAGGGGAGGAAAATGGG + Intergenic
1167818853 19:51907935-51907957 TTGAGAAAGGGGGAAAAAATAGG + Intronic
925112343 2:1347079-1347101 TTGGGAAAGAGGAAAAAAAAAGG + Intronic
926622927 2:15063520-15063542 TTGGGAAAGGGGAAACAATTTGG - Intergenic
926882145 2:17557716-17557738 TTGTGAGTGAGGAATAAAATGGG - Intronic
927425479 2:22976813-22976835 TTGGGAAAGGGAAGCAAAATGGG - Intergenic
927751925 2:25677075-25677097 GTTTAAAAGGGTAAGAAAATTGG + Intergenic
928050402 2:27988123-27988145 TGGTGAAAGGAAAACAAAATTGG + Intronic
928554424 2:32408619-32408641 TAGAAAAAGGGTAAGAAAATTGG - Intronic
928586497 2:32763862-32763884 TAGTGAAAGCTGAAGAAAATGGG + Intronic
929208418 2:39325184-39325206 CTGTAAAAGGGAAAGCAAATGGG - Intronic
929451632 2:42042006-42042028 TTGGGAAATGGAAAGAAAAGAGG - Intergenic
929914082 2:46119269-46119291 TTGTGAAAGAGAAAAAAAAAGGG + Intronic
930257919 2:49113003-49113025 GTGTGGAAGGGAAAGAAAACGGG + Intronic
930268245 2:49225051-49225073 TTGTGAAGGGGAAAGAATAAGGG + Intergenic
931019657 2:58029276-58029298 TGGTGAAGGTAGAAGAAAATTGG - Intronic
931303121 2:61000674-61000696 TTTCCAAAGGGGAAGAAAGTTGG - Intronic
931562282 2:63574445-63574467 TTCAGAAAGTAGAAGAAAATAGG - Intronic
931795529 2:65705678-65705700 TTGAGAAAGAAGAAGAAAGTGGG + Intergenic
931966261 2:67538626-67538648 TAGGGAAAGAGGAAGAAATTAGG - Intergenic
932021606 2:68093409-68093431 TTCTAAAAGGGAAAGAGAATGGG - Intronic
932099879 2:68889195-68889217 TGGTGACAGGGGCAGCAAATTGG - Intergenic
932501065 2:72183067-72183089 ATATGAAAGGGGGAGAAAAGGGG - Intronic
932828394 2:74962755-74962777 TCGGGAAAGGGGATGAGAATAGG - Intronic
932972052 2:76555777-76555799 TTTTGCAAGGTCAAGAAAATCGG - Intergenic
933372261 2:81429673-81429695 ATGTGATAGGGGAAAAAATTGGG - Intergenic
933788511 2:85864071-85864093 TTGTGGAAGGGGAGGTAGATAGG + Intronic
933872199 2:86577698-86577720 TTGTAAATGGAGAAGAAAAGGGG + Intronic
933927664 2:87112575-87112597 TCTTGAAAGAGGAAGAAATTTGG + Intergenic
934687608 2:96333309-96333331 TTATAGACGGGGAAGAAAATGGG + Intergenic
935054522 2:99554017-99554039 TTGTCACAGTGGAAAAAAATTGG + Intronic
936281955 2:111149330-111149352 TTTTGAAAGGAGAAGAAAGAGGG - Intronic
936658158 2:114512289-114512311 ATGTGAAAGGTGAAGGAAATTGG - Intronic
937187560 2:120059006-120059028 TTAAAAAAGGGGAATAAAATGGG + Intronic
937193227 2:120124767-120124789 TTATGAAAGGTAAAAAAAATAGG - Intronic
937473651 2:122195060-122195082 TTGGGAAAGGAGCAGAATATAGG - Intergenic
938227745 2:129630562-129630584 TTGAGAAAGGAGAAAATAATGGG - Intergenic
938239527 2:129732673-129732695 TTGGGAAGGGGAGAGAAAATAGG + Intergenic
938599920 2:132827013-132827035 ACGTGAAAAGGGAAGAAAAGAGG + Intronic
938614666 2:132984726-132984748 TTGTGAAATGGAGAGAAAATAGG - Intronic
938616762 2:133007344-133007366 ATGTGAGAAGGGCAGAAAATTGG + Intronic
938703879 2:133902887-133902909 CTGCGAAAGAGGAAGAAAATGGG + Intergenic
939313288 2:140512327-140512349 TAGTCAATTGGGAAGAAAATGGG + Intronic
939571617 2:143846755-143846777 TGGTGGAATGGAAAGAAAATTGG + Intergenic
939675842 2:145071152-145071174 TTTTGGAAGGGGCAGAAATTTGG - Intergenic
939718835 2:145621433-145621455 ATATTAAAGAGGAAGAAAATGGG - Intergenic
941040373 2:160614943-160614965 TAGAGAAAGGGAAGGAAAATAGG + Intergenic
941082586 2:161078994-161079016 TTATGACAAGGGTAGAAAATGGG - Intergenic
941189167 2:162355169-162355191 TTGTAAAAAAGGAAGAAACTGGG - Intronic
941903326 2:170698036-170698058 TTTTTAAAGGGGAAAAAAACTGG + Intergenic
942345853 2:175002220-175002242 ATTTGAAAGGAGAAGAAAAACGG + Intronic
942432133 2:175923276-175923298 TTTTGAAGGGTGAAGAAAGTGGG - Intergenic
942588876 2:177518856-177518878 TTTTTGAAGAGGAAGAAAATGGG + Intronic
942954195 2:181755007-181755029 CTGGGTATGGGGAAGAAAATAGG + Intergenic
943340982 2:186681974-186681996 TTGTGAAAATGCAAGAAAAGGGG + Intergenic
943732254 2:191314796-191314818 TTAAGAAAGGAGAAGAATATTGG + Intronic
944243786 2:197511538-197511560 GTCTCAAAGGGGAAGAAAAAGGG + Intronic
944285830 2:197948872-197948894 TTGGTAAAGGGGCAGTAAATAGG + Intronic
944362275 2:198871052-198871074 CTGTAGAAGTGGAAGAAAATAGG + Intergenic
944888449 2:204089832-204089854 TTGTGAAATGGCTAGAGAATGGG + Intergenic
945054144 2:205853369-205853391 TAGTGACAGGGAAAGGAAATAGG - Intergenic
945091718 2:206182070-206182092 TTGTGGAGGGGGAAGAAGATGGG + Intronic
945232598 2:207608213-207608235 CTGGGAAAGAGGAAGAAATTGGG - Intronic
945459698 2:210091370-210091392 TTTTAAAAGGTTAAGAAAATAGG - Intronic
945499369 2:210551259-210551281 TTGTGAAATGAGAAGAACAGTGG - Intronic
945559279 2:211318778-211318800 TTCTGAAAAGCTAAGAAAATTGG + Intergenic
946116922 2:217471098-217471120 CTGTGAAAGACAAAGAAAATTGG - Intronic
946436068 2:219655431-219655453 TTGTAAAAGGAGAATAAAGTGGG + Intergenic
946469261 2:219941367-219941389 TGCTGCAAGGGGAAGAAACTAGG - Intergenic
946531798 2:220578321-220578343 TTGAGAAAGGGAAAGGAGATGGG + Intergenic
947064535 2:226207683-226207705 TTGTGAAATGTGTTGAAAATTGG - Intergenic
947068061 2:226252670-226252692 CTGTGAAATGGGAATAAATTTGG - Intergenic
947922359 2:233888428-233888450 TTGAGGAAGAGGATGAAAATGGG + Intergenic
948722290 2:239908650-239908672 TTAGGAAAGGACAAGAAAATGGG + Intronic
1169585271 20:7075017-7075039 TTTTAGAAGAGGAAGAAAATTGG - Intergenic
1170341539 20:15333446-15333468 GAGAGAAAGGGGAAGAGAATTGG + Intronic
1170475877 20:16713998-16714020 CTGAGAAAAGGGAAGAACATCGG - Intergenic
1170611736 20:17919667-17919689 TTGAGAAAGAGAAATAAAATGGG + Intergenic
1172767734 20:37359639-37359661 GTGAGAAAGGGGAAGAACAGGGG + Intronic
1172861809 20:38060258-38060280 TTTTGTAAGGGGAGGAACATAGG - Intronic
1173062997 20:39680050-39680072 TGGTGGAAGGGGAAGTAAACAGG + Intergenic
1173201093 20:40955558-40955580 GTGTGGGAGGAGAAGAAAATAGG + Intergenic
1174724734 20:52849747-52849769 TGGTGAAAGAGGAGGAAAAAGGG + Intergenic
1175029219 20:55935529-55935551 AATGGAAAGGGGAAGAAAATTGG + Intergenic
1175472296 20:59239142-59239164 TGGAGAAAGGGGAAGAAAAATGG - Intronic
1176904562 21:14483840-14483862 CTGTGAAGGGGGAAGAATAGAGG + Intergenic
1176929189 21:14787854-14787876 TTGGGAAAGGAGCAGACAATTGG + Intergenic
1177021994 21:15873419-15873441 TTTTAAAAAGGGAAGAAAAGGGG - Intronic
1177240876 21:18455142-18455164 TGGTGGAAGGGGAAGCAAACAGG - Intronic
1177303247 21:19277690-19277712 ATGTGAAAAGGGAAATAAATTGG + Intergenic
1177814180 21:25958228-25958250 TTGTGATAGGAGAAGAAAAGGGG - Intronic
1178228793 21:30756228-30756250 TAGTGAAAGGAGAAGAAAAATGG - Intergenic
1178303969 21:31474940-31474962 CGGTGAAATGGGAAGATAATTGG + Intronic
1178826046 21:36017810-36017832 CTCTGAAAGGGGAAGAAGAGAGG - Intergenic
1179136415 21:38683854-38683876 TTGTGTAAGGGGCAGAAGAGAGG - Intergenic
1179191979 21:39131068-39131090 TGGAGAAGGGGGAAGAACATGGG + Intergenic
1179414149 21:41184870-41184892 TTGTAAAAGAGAAGGAAAATGGG - Intronic
1181623547 22:24106975-24106997 ATCTGAAAGGAGCAGAAAATGGG + Intronic
1182643188 22:31785656-31785678 TTGTAAAAGGGGAACGAAGTTGG + Intronic
1182936306 22:34225332-34225354 CAGTGAGAGGAGAAGAAAATAGG + Intergenic
1183594480 22:38802377-38802399 TGGTGCAGGAGGAAGAAAATGGG - Intergenic
1184686463 22:46098570-46098592 TTGTGAATGTTGATGAAAATTGG + Intronic
1184939104 22:47747929-47747951 GTTTGAGAGGTGAAGAAAATAGG + Intergenic
1185084213 22:48729841-48729863 TTGTGGAAGGAGATGATAATTGG - Intronic
1185088033 22:48751193-48751215 TGGCGAAAGGGGCAGGAAATGGG - Intronic
949444336 3:4117507-4117529 TTTTCGGAGGGGAAGAAAATAGG + Intronic
949531352 3:4958765-4958787 CTGTGAAAAAGCAAGAAAATAGG + Intergenic
949714116 3:6908556-6908578 CTGTGAAAAGGCAAGCAAATAGG - Intronic
949721142 3:6991560-6991582 TTGAGAAAGAAGAAGAAAAATGG + Intronic
949818378 3:8087346-8087368 GTGTGGAATGAGAAGAAAATAGG - Intergenic
949841845 3:8328491-8328513 GAGTGCATGGGGAAGAAAATGGG - Intergenic
950332915 3:12170636-12170658 TTATGAAATGGGAAGAACTTGGG + Intronic
950761768 3:15236180-15236202 TTGTGAAAGGGGAAGAAAATAGG + Intronic
950799338 3:15536917-15536939 TAATGGAAGGGGAAGAACATAGG - Intergenic
950970497 3:17181962-17181984 TTATTAAAGGAGAACAAAATTGG - Intronic
951666304 3:25127636-25127658 TGGGGAAAGGGGAAGAGAGTGGG + Intergenic
951701723 3:25503599-25503621 TATAGAAATGGGAAGAAAATGGG + Intronic
951851237 3:27142541-27142563 TTGTGTGAAGGGAAGAAAAGAGG - Intronic
952495651 3:33913702-33913724 TGGTGAAAGGAGAAGACAAGAGG - Intergenic
952636102 3:35534165-35534187 TTAAGAAAGAGGAAGAAGATAGG + Intergenic
952827323 3:37535267-37535289 TTGTGAAAGTGAAGGTAAATTGG + Intronic
953017406 3:39091153-39091175 ATGTCAGAGGGAAAGAAAATGGG + Intronic
953243373 3:41169081-41169103 TTGTCCAAGGGGAAAAAAAAAGG - Intergenic
953368647 3:42368505-42368527 TTGTGAAAGGGAAAAAAAGCAGG - Intergenic
953504773 3:43474226-43474248 ATGTGAAAAAGGAAGAAATTGGG - Intronic
953992697 3:47496423-47496445 ATGTGAAAGAGGAAAAAAAAAGG + Intronic
954055354 3:48018832-48018854 TTTAGAAAGTGGAAGAAAATAGG - Intronic
954243605 3:49313216-49313238 TAGTGAAAGGCAAAGAAAAATGG + Intronic
954407556 3:50353910-50353932 CAGAGAAAGGGGAAGGAAATGGG - Exonic
954984974 3:54782321-54782343 TTGTGAAATGGAAAGAATAGTGG + Intronic
955037169 3:55280197-55280219 TTGTCAAATGGGAAGACATTAGG - Intergenic
955298238 3:57753600-57753622 TTGGGAAGGGGGAAGGAAAAAGG - Intergenic
955840586 3:63108776-63108798 TTGTTAAAGTAGAAGTAAATAGG + Intergenic
955867925 3:63405132-63405154 TTGAGAAAGGGGAAGGACAGAGG - Intronic
956183635 3:66542275-66542297 GGCTGAAAGGGGATGAAAATGGG - Intergenic
956214619 3:66835680-66835702 CTGTGTAAAGGGAAGAAAATGGG + Intergenic
956702299 3:71969016-71969038 TTGGGAATAAGGAAGAAAATTGG + Intergenic
956715924 3:72079963-72079985 GAGAGAAAGGGGAAGAAAAAGGG - Intergenic
956884031 3:73540661-73540683 TGGTGAAAGGGGAGGTAAACAGG - Intronic
957194682 3:77052235-77052257 TTTTTAAAGGGAAAGAAAATGGG - Intronic
957274827 3:78077370-78077392 TTGGGACAGGGGAAGCAAAATGG + Intergenic
957371977 3:79306259-79306281 TGATGGAAGGGGAAGAAGATAGG + Intronic
957544286 3:81616634-81616656 TTGTAAAAGTGGAATAAAGTGGG - Intronic
957568531 3:81916052-81916074 TTGTGAAAGTGGAAAATGATGGG - Intergenic
958122512 3:89309838-89309860 TTGTGAAAAGAGAAGAAAGAAGG - Intronic
958561193 3:95748524-95748546 TAGTAAAAGGGCAAGAAAAAAGG + Intergenic
958604794 3:96343210-96343232 TTGTAAAAGGGAAAGAGAATAGG - Intergenic
959308586 3:104700870-104700892 TTGTGAAAGGAAAATAAATTTGG + Intergenic
959622402 3:108412364-108412386 TGGTGGAAGGGGAAGCAAATAGG - Intronic
961027725 3:123574582-123574604 TTTTGAAAAAGGAAGACAATAGG - Intronic
961195776 3:125000169-125000191 CTCTGAAAGGAGAAGTAAATAGG + Intronic
961224410 3:125227269-125227291 TTGAGAAAAGGTCAGAAAATGGG + Exonic
961705816 3:128784388-128784410 GTGTGAAAGCAGAAGAGAATGGG - Intronic
961744760 3:129057444-129057466 TTGAGCAACAGGAAGAAAATTGG + Intergenic
962420205 3:135221240-135221262 CTATGCAATGGGAAGAAAATTGG - Intronic
963345787 3:144095481-144095503 GGGTGAAAGGGGAAGAAAGGGGG - Intergenic
963881431 3:150533189-150533211 ATATGGAAGGGGAAGGAAATTGG - Intergenic
964012760 3:151910737-151910759 TTGCTAATGGAGAAGAAAATGGG - Intergenic
964424513 3:156537003-156537025 TTATGCAATGGGAAGAATATGGG + Exonic
965266136 3:166546366-166546388 TTGTGAAAAGAGAAGAGAAAGGG + Intergenic
965269282 3:166591875-166591897 TTTTGAAAGGGGAGGAAAATAGG - Intergenic
966560728 3:181317369-181317391 TTGGGAAATGGGAATACAATAGG + Intergenic
967476729 3:189929993-189930015 TTGTGAAAGGAGAAGTAAAGGGG - Intergenic
968191445 3:196670657-196670679 GGGGGAAAGGGGAAAAAAATGGG + Intronic
968261229 3:197325811-197325833 GTGTGAAAGGTTAAGAAGATGGG - Intergenic
968810342 4:2796964-2796986 TTGTGAAATGGGGTGAAAGTAGG + Intronic
969017979 4:4117839-4117861 TTGTAAAAGAGGAACAAAGTTGG - Intergenic
969698695 4:8752769-8752791 TTGTAAAAGGAGAACAAAGTTGG + Intergenic
970105098 4:12573736-12573758 TTGTGAAAGGACAGGAATATGGG - Intergenic
970321606 4:14880487-14880509 TTCGGAAAGGGGAAGGAAATGGG + Intergenic
971181963 4:24337177-24337199 TTGTGAAACAGGCAAAAAATTGG + Intergenic
971201305 4:24511688-24511710 TAGTGAAAGGGTAGGACAATTGG - Intergenic
971529642 4:27670312-27670334 TTCTGACAGGAGGAGAAAATTGG + Intergenic
971861006 4:32105512-32105534 TTGTCAAATCGGAAGAAGATTGG - Intergenic
971870952 4:32237793-32237815 TGGTGAAAGAGGAAGAAAAATGG + Intergenic
972034115 4:34499225-34499247 ATGTAAAAGGCGGAGAAAATAGG + Intergenic
972064572 4:34924768-34924790 GAGTGAAAGAGGAAGAAAAAAGG + Intergenic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
972463723 4:39331454-39331476 TTGTAACAGGGCAAGAAAAGGGG + Intronic
972561260 4:40231057-40231079 TTAAGCAAGGAGAAGAAAATGGG + Intronic
973001747 4:44960903-44960925 TGGGGAAAGGGGAAGGAAAAGGG - Intergenic
974318294 4:60310700-60310722 TTCTAAAATGGGGAGAAAATTGG - Intergenic
974816562 4:67012253-67012275 GTTTGAAAGGGGAGGGAAATGGG + Intergenic
975046578 4:69811780-69811802 TTGGTAAAGAGGAAGAAAATGGG - Intronic
975772926 4:77749007-77749029 TTTTGAAAGGAAAAGAAAAGGGG - Intronic
976377997 4:84366721-84366743 TTTTTAAAGGGGGAGAAAAGGGG - Intergenic
976751362 4:88453696-88453718 TTATGAAAGTGGAAGATAGTGGG - Intergenic
976885157 4:89973418-89973440 ATGTTACAGGTGAAGAAAATGGG - Intergenic
977541747 4:98326380-98326402 TTGAGAATGGGGAAGAAAAAAGG - Intronic
978552689 4:109944802-109944824 ATGAAAATGGGGAAGAAAATAGG - Intronic
979102915 4:116645095-116645117 TTGTGGAAAGGGAAGTAAACAGG - Intergenic
979121935 4:116914227-116914249 TTGAGAAAGGGGAATAAGAAAGG - Intergenic
979817784 4:125131864-125131886 TGCTGAAAGGGGAAGAAAAATGG - Intergenic
979851183 4:125573123-125573145 TTTGGAAAGGGGAGGAAAAAGGG - Intergenic
980619475 4:135279961-135279983 TAGAAAAAGGGGAAAAAAATAGG + Intergenic
981854446 4:149271372-149271394 TTGTGAAAGATGTAGCAAATGGG + Intergenic
981957439 4:150495156-150495178 CTGTGACAGAGGAGGAAAATGGG - Intronic
982159203 4:152550637-152550659 TTCTAAAAGGGGGAAAAAATGGG + Intergenic
982958204 4:161798875-161798897 GAGTGAAATGGGAAGAAAAGTGG + Intronic
983293048 4:165830947-165830969 TTGTGAAAGAAGAGGAAAAGAGG - Intergenic
983545522 4:168959475-168959497 TTATAAAAGGTGAACAAAATTGG - Intronic
983747670 4:171221735-171221757 TTGTGAAAAGGAAAGAAAGGAGG - Intergenic
983857552 4:172664045-172664067 TTCAGAAAAGGGAAGAATATCGG + Intronic
984612236 4:181854482-181854504 GTTGGAAAGGGGAAAAAAATGGG - Intergenic
984654894 4:182307162-182307184 TTGTGAAGGGGGAGGAAAGTGGG + Intronic
984739562 4:183147170-183147192 TTCTGAAAAGAGAAGGAAATAGG + Intronic
984946107 4:184969798-184969820 GTGTGAAAGGTGAAGACAACTGG - Intergenic
985863091 5:2489760-2489782 TTGTGAAAGTGGAAGCTGATTGG - Intergenic
986455058 5:7909932-7909954 TTTTGAAAGAGGAAGTACATGGG + Intergenic
988949697 5:36243489-36243511 CTGTGAAATGGGAAGAAATGAGG - Intergenic
989295107 5:39816496-39816518 TTGGGAAAACTGAAGAAAATAGG - Intergenic
989316151 5:40081443-40081465 TTGTGAAGGGAGAAGAAAAATGG + Intergenic
989546098 5:42675551-42675573 TTGTGAAAGCGAAAGGAAAGAGG + Intronic
990084781 5:51961779-51961801 TTTTGAAAGGGAAAAAAAATCGG - Intergenic
990742817 5:58929683-58929705 GTGGGAAAGGGGCAGAAAAGAGG - Intergenic
993220807 5:85094692-85094714 TTTTGAGAGGTGAAGAGAATAGG - Intergenic
993387618 5:87278672-87278694 TGGTGAAATGTGAACAAAATAGG - Intronic
994078003 5:95674775-95674797 TTGTTGAAGGAGAAGAAAATGGG - Intronic
994078934 5:95684433-95684455 TGATGAAAAGAGAAGAAAATTGG - Intronic
994512373 5:100720906-100720928 TTGTAAAAGGGGAGATAAATTGG - Intergenic
994673212 5:102787553-102787575 TAGTGAAAGGTACAGAAAATAGG + Intronic
994777165 5:104049564-104049586 TAGGGAAAGGGGAAGTAAACAGG - Intergenic
994990472 5:106990196-106990218 TTATGAAATGAGAAGAAAAAAGG + Intergenic
995017367 5:107326132-107326154 TTTGGAAAGAGGAAGAATATGGG + Intergenic
995097048 5:108249147-108249169 TGGTGAAAAGGGAAAAAAATGGG - Intronic
995165438 5:109034503-109034525 TTGTGAAAGCAGAAGCCAATAGG - Intronic
995273469 5:110250147-110250169 TTGTGACAGGGAAAAAAATTAGG - Intergenic
995536503 5:113141866-113141888 TTGAGAAAGTGAAAGCAAATGGG - Intronic
995580937 5:113601464-113601486 TTGTGTAGGGGGAAGAGAAGAGG - Intergenic
995731588 5:115249138-115249160 TTGTGGAGGGGGAAGTAGATGGG - Intronic
995849290 5:116528204-116528226 TTGGGAAATGAGAAGCAAATCGG - Intronic
995990280 5:118230235-118230257 TTGTGTATTGGGAAGGAAATTGG - Intergenic
996591382 5:125152137-125152159 TTGTGGGAGGGGAGGAATATTGG + Intergenic
997391388 5:133520092-133520114 CTGAGAAAGGAGAAGAAAAGAGG - Intronic
997795723 5:136808973-136808995 TTGTGAGAGGCAAAGAAAATAGG - Intergenic
998224903 5:140319388-140319410 GAGTGAAAAGGGAAGAACATAGG - Intergenic
998364551 5:141620815-141620837 TTATGAAAGGAGAGGGAAATGGG - Intergenic
998405956 5:141874839-141874861 CGGGGAGAGGGGAAGAAAATGGG + Intronic
998669626 5:144339212-144339234 TTGTAAAATGAGAATAAAATTGG - Intronic
999045087 5:148458707-148458729 TGGTGAGAGGGGAACAAAGTAGG + Intronic
999698146 5:154204302-154204324 GTGGGAAGCGGGAAGAAAATAGG - Intronic
999777427 5:154822358-154822380 TTTTTAAATGGGAAGAAAAAGGG + Intronic
1000139439 5:158387734-158387756 TAGTGAAGGGGAAAGGAAATGGG - Intergenic
1000221975 5:159223038-159223060 TTTTAAAAGGGGGAGATAATTGG - Intergenic
1000508858 5:162156821-162156843 TTGTCAAAGGTGTAGAATATGGG + Intergenic
1000776848 5:165430186-165430208 TTGAGAAATGGAAAGAAAACAGG - Intergenic
1001074509 5:168615457-168615479 TTGGGAAAGAGCAAGTAAATAGG + Intergenic
1002019617 5:176354679-176354701 TTGTGATTGGGGAAAAAAATTGG - Intronic
1002040852 5:176513073-176513095 TAGTTAAAGGGGAAGAAACCTGG - Intergenic
1002260752 5:177992644-177992666 TCGTGAAAAGACAAGAAAATGGG - Exonic
1002294251 5:178221255-178221277 TTGTGTAAGGGGAACAACAAAGG - Intronic
1003514831 6:6809288-6809310 CAGTGAAGGGGGAAGAAAGTAGG + Intergenic
1003527416 6:6909784-6909806 GTCGGAACGGGGAAGAAAATGGG - Intergenic
1003583140 6:7360572-7360594 TTGAGATATGGGAAGAAGATTGG + Intronic
1004448056 6:15719894-15719916 TTGGCAAAGGGGAAGAAAGGAGG - Intergenic
1004673223 6:17816868-17816890 TTGTGAAAGGAAAAGCTAATTGG + Intronic
1004706965 6:18133572-18133594 TTGTGAATGGTAAACAAAATGGG + Intronic
1005316822 6:24611123-24611145 TTGGGAGATTGGAAGAAAATGGG + Intronic
1005380690 6:25231547-25231569 TTCTGAAGAGGGAAGAAAGTGGG + Intergenic
1005387113 6:25296228-25296250 TAGTGAAAGGGTCAGGAAATTGG - Intronic
1005397570 6:25399049-25399071 CTGTGAGCGGGGAAGAAAAGGGG - Intronic
1005980579 6:30833515-30833537 TTGTGAAGGAGGCAGCAAATAGG - Intergenic
1006004928 6:30994007-30994029 TCTTGAGAGAGGAAGAAAATGGG + Intergenic
1006343283 6:33459127-33459149 TTGGGAAAGGGGATGAAGAGGGG + Intergenic
1007026596 6:38582280-38582302 TTGTTAAATAGGAAGAATATGGG - Intronic
1007495045 6:42254072-42254094 TTGTGAAAAGTGAAGGAAATAGG - Intronic
1007977020 6:46112392-46112414 TTATGAAAGGGGGAAAAGATGGG - Intergenic
1007977423 6:46115609-46115631 TTGTAGAAGGTGAACAAAATTGG - Intergenic
1008355546 6:50548278-50548300 TTGTGACAGGGGAAAGAAAATGG - Intergenic
1008636785 6:53418744-53418766 TTGGGAAAGAGGAGGAAAACTGG + Intergenic
1009948867 6:70371923-70371945 ATGGGAACAGGGAAGAAAATTGG + Intergenic
1010694830 6:78958758-78958780 TTGTGTTAGGGGAAAAAAAGAGG + Intronic
1011023976 6:82845880-82845902 TTGTAAAATGGGGAGAAAAGAGG + Intergenic
1011715552 6:90101610-90101632 TTGCAAAAGAGGAACAAAATTGG - Intronic
1011816945 6:91203085-91203107 TTGTGAAGGGGGAGGAATAATGG - Intergenic
1011889031 6:92133734-92133756 ATGTGGAATGGAAAGAAAATGGG - Intergenic
1012212159 6:96532627-96532649 TAGTGAAAGAGGAAGCAAAGGGG - Intronic
1012219670 6:96633537-96633559 TAGTGAAAGGACCAGAAAATGGG - Intergenic
1012458263 6:99430692-99430714 TTCTGAATGGGGAAGAAGAATGG - Intergenic
1012930355 6:105309948-105309970 GTAGGAGAGGGGAAGAAAATGGG - Intronic
1013040306 6:106426466-106426488 ATCAGAAAGGGGAAGAAAGTGGG - Intergenic
1013313348 6:108918204-108918226 TTGTGGAATGGGAAGAGAAAAGG + Intronic
1014192004 6:118506977-118506999 TTGTGCAATGAGAGGAAAATGGG - Intronic
1014667713 6:124259820-124259842 TGATGAAAGGTGAAAAAAATAGG - Intronic
1014792447 6:125689242-125689264 TTGTGACATGTGACGAAAATTGG - Intergenic
1014882927 6:126745615-126745637 TGGTAGAAGGGGAAGAAAACAGG + Intergenic
1016496155 6:144664227-144664249 TTGTGTCAGGGGAAGAAATTGGG + Intronic
1016776298 6:147908412-147908434 TTATGACAGTGGAAGTAAATGGG + Intergenic
1017173335 6:151478328-151478350 TTGTGAAAAGGAAAGAGAATTGG - Intergenic
1018379072 6:163241160-163241182 CTGAGAGAGGGGAAGAAAAAAGG + Intronic
1018555804 6:165049663-165049685 ATGCAAAAGGGGAAGATAATTGG - Intergenic
1019619404 7:1982655-1982677 TTGGGAAGGAGGAGGAAAATTGG - Intronic
1020503902 7:8959152-8959174 TTGTGAAAATGAAAGGAAATTGG + Intergenic
1020504005 7:8960471-8960493 TTGTGAAAATGAAAGGAAATTGG + Intergenic
1020510875 7:9055498-9055520 TTGAGAAAGGAGAACAAAGTTGG - Intergenic
1020754061 7:12179043-12179065 TTTTGAAAGGGGAAGTTTATTGG + Intergenic
1021050947 7:15983968-15983990 TAGGGAAATGGGTAGAAAATAGG + Intergenic
1021729182 7:23579965-23579987 TTCTGTAAGGAGAAGAGAATGGG + Intergenic
1021984757 7:26087672-26087694 TTACGAAAGGGCAGGAAAATAGG + Intergenic
1022237640 7:28477358-28477380 TTCTGAAAGGGAAAGAAAAAAGG - Intronic
1022348856 7:29546945-29546967 GTGTGAAAGGGGTAGAAATAGGG + Intergenic
1023114188 7:36844779-36844801 TGGTGAAAGGGTAATAAAACAGG - Intergenic
1023611934 7:41980578-41980600 ATATGAAAGGGAAAGAAAAAAGG + Intronic
1026277761 7:68895075-68895097 TGGAGAAAGGGGAAGAAGAAAGG - Intergenic
1026429541 7:70330567-70330589 TTGTAAAAGGAGAAAAAAGTTGG - Intronic
1027551532 7:79603036-79603058 TTGTGAAAGGAGATGGAAATTGG - Intergenic
1027593976 7:80149880-80149902 TTGTTAAATGAGAAGAAAAAAGG + Intronic
1027667744 7:81059879-81059901 TTTTGAAAGAGGAATAAAAAAGG + Intergenic
1028264972 7:88711958-88711980 TTGTGATGGGGGAAGAATAGAGG + Intergenic
1028701419 7:93785153-93785175 ATGTGATAGGGAAAGAATATAGG + Intronic
1030333143 7:108294640-108294662 TTGTGCAATGGGAAGGAAAATGG + Intronic
1030481545 7:110111058-110111080 TTGAGAAGGGAGAACAAAATTGG - Intergenic
1030507388 7:110442111-110442133 ATGCGAGAGGGAAAGAAAATAGG + Intergenic
1031052290 7:116956152-116956174 TACTTAAAAGGGAAGAAAATAGG - Intronic
1031105941 7:117542995-117543017 TTGTAACAGTGGATGAAAATAGG - Intronic
1031164330 7:118210156-118210178 TTATGAAAGGGAAAGGATATTGG + Intergenic
1032636579 7:133715490-133715512 TTTTGGAAGGGGGAGAAATTGGG + Intronic
1032719310 7:134537745-134537767 TCCTTAAAGGGGAAGAATATAGG + Intronic
1032863009 7:135899310-135899332 CTGTGAAATGGGAATAATATAGG - Intergenic
1033590691 7:142805843-142805865 TTGGGAAATTGGAAGAAAAAGGG + Intergenic
1033833570 7:145282519-145282541 TTTGGAAAGTGGAAGAAAAGTGG - Intergenic
1033953169 7:146811639-146811661 TTGATAAAGGGGAAAAAGATTGG - Intronic
1034051997 7:147993873-147993895 TTGTGAAGGGGGAAGGAAACAGG - Intronic
1034504299 7:151474150-151474172 TGGTTAAAGGGAAAAAAAATCGG - Intronic
1035440044 7:158889516-158889538 TTGGGAAACATGAAGAAAATAGG - Intronic
1035795230 8:2350034-2350056 TGGTGAAAGGGGAAGCAAACAGG - Intergenic
1036400226 8:8401270-8401292 ATGGGAAAGAGGCAGAAAATGGG + Intergenic
1036436639 8:8740709-8740731 TTGTGTATGGGGAAGATAAGGGG - Intergenic
1036478755 8:9119004-9119026 GTGTGAAGGGGGAAGAGAACTGG - Intergenic
1037016374 8:13912805-13912827 TTGTTAAAGGGAAATAAAAAGGG + Intergenic
1037730997 8:21524012-21524034 TTGTGAGCGGGGAAGAAAAGAGG - Intergenic
1038296550 8:26296750-26296772 TTTTGAAAGGGGAAGAGAAATGG + Intronic
1038507047 8:28093234-28093256 GTGCGAAAGGGGAAGGAGATGGG + Intronic
1038593400 8:28862159-28862181 TGGTGACAGAGGAAGAAAACTGG - Intronic
1038626440 8:29197889-29197911 TTTTGAAACTGGAATAAAATAGG + Intronic
1039382813 8:37101637-37101659 TTGTGAGATGGAAAGAAAAAGGG - Intergenic
1040024307 8:42767741-42767763 GTCTTAAAGAGGAAGAAAATGGG - Intronic
1040750939 8:50706595-50706617 TTGTGAATGGGTAAGGAAATAGG - Intronic
1041457089 8:58072886-58072908 TTGTGAAAAGGAAAGAGAAATGG + Intronic
1042052547 8:64726916-64726938 TTGTGACAAGGGCAGAAAGTGGG + Intronic
1042298871 8:67253400-67253422 TTGTTCAAGGGGAAAAATATGGG - Intronic
1043013307 8:74907428-74907450 TTGTTATAGGGTGAGAAAATAGG + Intergenic
1043043346 8:75290007-75290029 TTGTTGAAGGGGAAGGGAATAGG + Intergenic
1043531268 8:81153242-81153264 TTGTTAAAAGGGAAAAAAACAGG + Intergenic
1043948286 8:86278663-86278685 TTTTAAAAAGGGAAAAAAATGGG - Intronic
1044089350 8:87979806-87979828 TTATGAAAGAGTAAGAATATTGG + Intergenic
1044142188 8:88670252-88670274 TTATGAAAAGGGAAAAGAATAGG + Intergenic
1044395165 8:91702836-91702858 TTTGGAAAGAGGAAGAAAAATGG - Intergenic
1046272948 8:111919530-111919552 CTGGGAAAGGGAAAGAAAAAGGG - Intergenic
1046473956 8:114716204-114716226 GTGTGAAAAGGCAAGAAAACAGG - Intergenic
1046815918 8:118583565-118583587 AGGTGATAGGGGAAGAGAATAGG - Intronic
1047088974 8:121552462-121552484 TTGTGAAATAGGAAGAGAACTGG + Intergenic
1047154609 8:122302850-122302872 TTGTGAAAGTGGTAGAAATAGGG + Intergenic
1050242095 9:3647468-3647490 TTGTGAAAGGGTAAGAGAACTGG + Intergenic
1050716821 9:8538115-8538137 TTGTGAAAGTGGATGGATATTGG - Intronic
1051512679 9:17896520-17896542 TTGTGGAAGGGGACGGAAACAGG + Intergenic
1051721270 9:20039687-20039709 TGGGCACAGGGGAAGAAAATGGG + Intergenic
1053092949 9:35296477-35296499 TTATGAAACAGGAAGAAGATGGG - Intronic
1054234932 9:62548251-62548273 TTGAGAAACTGGGAGAAAATGGG + Intergenic
1054846390 9:69803002-69803024 TTGTGTAATGGAAAGTAAATGGG + Intergenic
1055661275 9:78506450-78506472 GCTTGAAAGGGGAAGAAAACAGG + Intergenic
1055744928 9:79433120-79433142 ATGAGAAAGAGGAAGAAAAAAGG - Intergenic
1056237760 9:84612378-84612400 TTGTCTCTGGGGAAGAAAATTGG - Intergenic
1056267149 9:84909076-84909098 TTATGAATGGGGAGGAAAGTGGG - Intronic
1056407978 9:86294177-86294199 TTGTGAAAGGGGAATTAGAAAGG - Intronic
1057079868 9:92165361-92165383 TAGAGAAAGGGGAAGGAGATAGG + Intergenic
1057921109 9:99097909-99097931 TTATGAGATGGCAAGAAAATAGG + Intergenic
1058788672 9:108418517-108418539 TTCTGACAGGGGAAGAAGAAAGG + Intergenic
1059092443 9:111374249-111374271 TTGTGAAAAAGAAAGAAAACTGG + Intronic
1059358726 9:113722041-113722063 TTGTAAAAGAGGAACAAAGTTGG + Intergenic
1059918135 9:119126775-119126797 TTTTGTAAAGGGAAGAAAATGGG + Intergenic
1060220699 9:121762715-121762737 TTGGGGGAGGGGAAGAAAATAGG - Intronic
1060334362 9:122707400-122707422 TTGTTACAGGGGCAGAAAACTGG - Intergenic
1061541948 9:131282361-131282383 TTGTGTGAGGGGATGAAAGTGGG + Intergenic
1061667017 9:132166487-132166509 TTGTGACAGTGGATGGAAATGGG - Exonic
1185454693 X:302947-302969 TTGGGAAAGGGGAGTAAAAATGG - Exonic
1185551175 X:983492-983514 TTGGGAAAGGGCAGGCAAATAGG - Intergenic
1186089976 X:6036184-6036206 TTGGAAAAGGGGAAGAAAGTTGG - Intronic
1186247519 X:7630601-7630623 TTTAGAAAGGGGAATAAATTTGG - Intergenic
1186547951 X:10470562-10470584 TTGAGAAATGAGAAGAAAATAGG - Intronic
1186568489 X:10689768-10689790 ATGTGTAAGGAGAAGGAAATTGG - Intronic
1187495539 X:19792602-19792624 TAGAGAAAGGGGAAGAAGACAGG + Intronic
1187809169 X:23156767-23156789 TTGTAAAATGGGAATAATATTGG - Intergenic
1188003268 X:25001422-25001444 GTTTGGAAGGAGAAGAAAATTGG + Intergenic
1188172037 X:26939378-26939400 TTGTGGAAGGGGAATACAAAAGG + Intergenic
1189032673 X:37466266-37466288 TTGTAAGAGGGAGAGAAAATGGG + Intronic
1189198122 X:39168603-39168625 ATGAGAAACGTGAAGAAAATAGG + Intergenic
1189818143 X:44844802-44844824 TTGTTAAAGGGCAAGAAAAAAGG + Exonic
1190562453 X:51698853-51698875 TTCTGAAAAGGGAAATAAATGGG - Intergenic
1191219215 X:57968845-57968867 GTGTGAAAGGGGATAAAAAGAGG - Intergenic
1191705934 X:64094585-64094607 TTGGGAATGGGGAAGAAAGCTGG - Intergenic
1191928196 X:66339050-66339072 TTGTATAAGGTGAAGAAAAGTGG + Intergenic
1191972604 X:66833336-66833358 TTTGGAAAGGGGAGGAAAAATGG + Intergenic
1191982278 X:66939573-66939595 TTGACACAGGGGAAAAAAATTGG - Intergenic
1192458990 X:71301390-71301412 CTCTGAAAGAGGAAGAAAATGGG + Intergenic
1192735710 X:73847798-73847820 ATGTAAAAGGGGTAGAATATAGG + Intergenic
1192797457 X:74435880-74435902 TTGAGAAAGGGGAAGGGACTTGG - Intronic
1192957393 X:76087330-76087352 TTGTGACATGTGAAGAAAAGTGG + Intergenic
1193415354 X:81215783-81215805 TAGTGAAATGGCAAGAAAATTGG - Intronic
1193470840 X:81901003-81901025 TGGTGGAAGGAGAAGAAATTCGG - Intergenic
1193754138 X:85385709-85385731 TTGTGAAAAGGGAAGACAAACGG + Intergenic
1194414878 X:93598835-93598857 TTAAGAAAGGGGAAGAAAAGGGG + Intergenic
1194527403 X:94994317-94994339 TTGTGAAAGAAGAATAAAGTTGG - Intergenic
1194875737 X:99185580-99185602 ATGGGAAAGGGGAGGAAATTGGG - Intergenic
1195992898 X:110700521-110700543 TTGAGAAAAGGGAAGAAAAATGG + Intronic
1197409862 X:126103444-126103466 TTGGAAAAGGGGAACAAATTTGG + Intergenic
1197728252 X:129790772-129790794 TTACAAAAGGGGAAGAAACTAGG + Intronic
1198848397 X:140938519-140938541 TTGAGAAAGGGGAAAAAAATTGG + Intergenic
1198873466 X:141199459-141199481 GTGTTATAGGGCAAGAAAATGGG - Intergenic
1199135430 X:144244283-144244305 TTGGGAAGGGGGAAGAATAGTGG + Intergenic
1199540131 X:148949315-148949337 GAGTGACAGGGGAAAAAAATGGG - Intronic
1199555428 X:149102967-149102989 GTGTTAAAGAGGAAGAAAATTGG - Intergenic
1199739484 X:150719908-150719930 GAGTGAAAGGAAAAGAAAATGGG - Intronic
1200871606 Y:8105195-8105217 TTTGTAAAGGGGAAGAGAATCGG - Intergenic
1201507129 Y:14714540-14714562 TTGGAATAGGGGAAGAAAGTTGG + Intronic