ID: 950762362

View in Genome Browser
Species Human (GRCh38)
Location 3:15243352-15243374
Sequence CTGCATCTTCATTTGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 256}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950762362_950762366 9 Left 950762362 3:15243352-15243374 CCTGGCTCCAAATGAAGATGCAG 0: 1
1: 0
2: 1
3: 30
4: 256
Right 950762366 3:15243384-15243406 TGGATTTTTGAATAGAGTTCTGG 0: 1
1: 0
2: 1
3: 43
4: 2319
950762362_950762368 11 Left 950762362 3:15243352-15243374 CCTGGCTCCAAATGAAGATGCAG 0: 1
1: 0
2: 1
3: 30
4: 256
Right 950762368 3:15243386-15243408 GATTTTTGAATAGAGTTCTGGGG 0: 1
1: 0
2: 1
3: 24
4: 286
950762362_950762369 16 Left 950762362 3:15243352-15243374 CCTGGCTCCAAATGAAGATGCAG 0: 1
1: 0
2: 1
3: 30
4: 256
Right 950762369 3:15243391-15243413 TTGAATAGAGTTCTGGGGTAAGG 0: 1
1: 0
2: 1
3: 9
4: 158
950762362_950762367 10 Left 950762362 3:15243352-15243374 CCTGGCTCCAAATGAAGATGCAG 0: 1
1: 0
2: 1
3: 30
4: 256
Right 950762367 3:15243385-15243407 GGATTTTTGAATAGAGTTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 242
950762362_950762370 17 Left 950762362 3:15243352-15243374 CCTGGCTCCAAATGAAGATGCAG 0: 1
1: 0
2: 1
3: 30
4: 256
Right 950762370 3:15243392-15243414 TGAATAGAGTTCTGGGGTAAGGG 0: 1
1: 0
2: 1
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950762362 Original CRISPR CTGCATCTTCATTTGGAGCC AGG (reversed) Intronic
900098770 1:952079-952101 CTGCCTCTTCCTGTGGTGCCGGG - Exonic
900570340 1:3355197-3355219 CTGCAGCTGCATCTGGGGCCAGG + Intronic
900580193 1:3404968-3404990 CTCCATCTACATTTGGACCAGGG - Intronic
901035864 1:6335697-6335719 CTGGGGCTTGATTTGGAGCCTGG - Intronic
901103682 1:6738632-6738654 CTGCATTTTCATTTTGCACCAGG + Intergenic
901499611 1:9643726-9643748 CTGCTTCCTCATCTGTAGCCTGG - Intergenic
902104746 1:14025151-14025173 TTGCATCTGAATTTGGAGGCTGG + Intergenic
904027221 1:27512105-27512127 CTGCATCTTGATCTGGGGACTGG - Intergenic
904542389 1:31241760-31241782 CTGCATCTTCATTTTGTGCTGGG - Intergenic
907359622 1:53903917-53903939 CTGCATTTTCATTTGGCGGCAGG + Intronic
908500555 1:64739499-64739521 ATCCATCTGCTTTTGGAGCCCGG - Intergenic
909801171 1:79809508-79809530 CTGTATTTTCATTTGCAGCTTGG - Intergenic
911378422 1:97080394-97080416 ATGCAGCTTCATTTGGAGGGGGG - Intronic
911435091 1:97845896-97845918 CTGCAGCCTCACATGGAGCCGGG + Intronic
912124249 1:106513456-106513478 CTGCATTTTCTTCTGGAGCTTGG + Intergenic
912455611 1:109794829-109794851 CTGCCTCCTCATCTGCAGCCTGG - Intergenic
913718420 1:121564148-121564170 TTTCATCTTCATTTCTAGCCTGG + Intergenic
914672205 1:149879467-149879489 CTGCATTTTCATATGAAGCCTGG - Intronic
914830106 1:151165119-151165141 CTGGAGCATCAGTTGGAGCCCGG - Exonic
916548632 1:165828884-165828906 CTCCAACTTCATTTGGAGCACGG + Intronic
920036287 1:203067894-203067916 CTGCATCTTCCTTTTCAGACTGG - Intronic
920348385 1:205321515-205321537 CTGCTTCTTCATTAGGGGCTTGG + Exonic
920403232 1:205690415-205690437 CTGGAGCTTCATTTGGAGTCTGG - Intergenic
921941155 1:220841383-220841405 TTGCATTTTCATCTGGAGCTTGG + Intergenic
922172448 1:223167133-223167155 CTCCATCTTCAATGGGAGCTGGG + Intergenic
923986821 1:239391020-239391042 CTGCATCTTCCTTAGTAGCTAGG - Intronic
1063010296 10:2014993-2015015 CTGCATCTCCATTGGGAGGCAGG + Intergenic
1063370980 10:5523136-5523158 CAGCATCTCCATTTGCAGGCTGG - Intergenic
1063486649 10:6426444-6426466 GAGCATTTTCATTTGGAGCAAGG + Intergenic
1064552215 10:16514625-16514647 GTGGTTCTTCATTTGGAGCCGGG - Exonic
1064735483 10:18377999-18378021 CTTCATGTTAATTAGGAGCCAGG + Intronic
1065607282 10:27430880-27430902 GTGCATCTTCAGTTGCATCCAGG + Intergenic
1066059141 10:31706960-31706982 CTGCATCTGCAGCTGGTGCCAGG + Intergenic
1066641218 10:37556172-37556194 CTTCATCCTCATTTGTGGCCTGG + Intergenic
1067552096 10:47243464-47243486 CTGCATCTGAATTTGAACCCAGG + Intergenic
1070965917 10:80530333-80530355 CTGCTTCTTAATCTGGGGCCTGG - Exonic
1071405777 10:85329828-85329850 CTGTTTCTTCAGATGGAGCCTGG - Intergenic
1071513517 10:86282235-86282257 CTGCCTCTACCTTTGGAGGCTGG - Intronic
1072828142 10:98629212-98629234 CTCCAGCTTCATTTGGAGGGTGG - Intronic
1073897758 10:108183102-108183124 CTGCATCTCCATATGAAACCTGG + Intergenic
1074767061 10:116707248-116707270 CTGCATATTCATCTCCAGCCCGG - Exonic
1075312587 10:121427163-121427185 GTGCATCTTGATTTCCAGCCTGG + Intergenic
1076336394 10:129709630-129709652 CTGCATAATCATATGGAGGCTGG + Intronic
1076462813 10:130657987-130658009 CTGCACTCTCATTTTGAGCCTGG - Intergenic
1077005328 11:352544-352566 CTCCATCTTGATTAGGAGCTGGG - Intergenic
1078145254 11:8718069-8718091 CTGCTTCTGGACTTGGAGCCAGG - Intronic
1078147588 11:8732193-8732215 CTGCATATGGATTTGGAGCTGGG - Intronic
1078734755 11:14009782-14009804 CTGCATCTTCATGTGGAGGAAGG + Intronic
1080237634 11:30090194-30090216 CAGAATCTTCATTTGCAGACAGG - Intergenic
1081854655 11:46295819-46295841 CTGCACCCTCTCTTGGAGCCTGG - Intronic
1083602040 11:63954740-63954762 CTGCCTCCTCATTTGGCTCCTGG + Exonic
1084718471 11:70889091-70889113 CTGCACCCTCATTTGGAAACAGG + Intronic
1086550935 11:88050918-88050940 CTGCACCTCCATCTGGAGCCAGG - Intergenic
1087156295 11:94908121-94908143 CTGCATCTTCAATTCATGCCAGG - Intergenic
1087969856 11:104466754-104466776 ATGCATCTTCATTTGGCTCATGG + Intergenic
1089283747 11:117392503-117392525 CTGTATCTTCTTCTGGAGGCTGG - Exonic
1089749644 11:120641856-120641878 CTGCATCTTGAATAGGAGCTGGG - Intronic
1090588954 11:128244661-128244683 CTGCATTTTCATTTGGAATTGGG - Intergenic
1091088816 11:132749793-132749815 CTGTTTCTTCACTTGGACCCAGG - Intronic
1092302632 12:7266722-7266744 CTGCATGTTCATATGGTCCCTGG + Intergenic
1092354921 12:7786842-7786864 CTCCATCTTCAATAGGAGCTGGG - Intergenic
1092367629 12:7890170-7890192 CTCCATCTTCAATAGGAGCTGGG - Intronic
1093067716 12:14675934-14675956 CTGCATCCTCTTTTGGAGCTGGG - Intronic
1094317857 12:29151576-29151598 CTGGATCTTCATTTTGAACTGGG + Intronic
1094497229 12:30995921-30995943 CTGCATCTTCCTTTGGTGTTTGG - Exonic
1094549994 12:31441640-31441662 CAACAACTTCATTTGGAGCTGGG - Intronic
1097730588 12:63123777-63123799 CTGCATTTTCTTTTTGTGCCAGG + Intergenic
1097900379 12:64867082-64867104 CAGCATGATCATTTGAAGCCAGG + Intronic
1098182601 12:67863859-67863881 CTGCATCTTCATATGGCGGAGGG + Intergenic
1098571584 12:71993562-71993584 CTGAGCTTTCATTTGGAGCCAGG - Intronic
1098816420 12:75170883-75170905 CTGCATACTCATTTGGGGGCGGG + Intronic
1099279641 12:80627469-80627491 ATGCATCTTTATCAGGAGCCAGG + Intronic
1099298458 12:80861237-80861259 CTGCCTCTTCATTTTGTTCCCGG + Intronic
1100370398 12:93964357-93964379 CTGCAACTTCATATGAAACCTGG - Intergenic
1101518532 12:105460117-105460139 CTGGATCCTTATTTGGAGGCAGG + Intergenic
1101550556 12:105757468-105757490 TGGCATCTGCATTTGCAGCCGGG - Intergenic
1102040216 12:109796200-109796222 CAGCTTCTTCATTTGTAACCTGG - Intronic
1102261024 12:111443349-111443371 CTGCATTTCCATGTGGACCCTGG + Intronic
1102867703 12:116387096-116387118 TTGCATCTGCATTGGGAGCCTGG - Intergenic
1102874097 12:116436451-116436473 CTGCATTTTCATTTCGCCCCGGG + Intergenic
1106331825 13:28746413-28746435 CTCCATCTTGAATAGGAGCCGGG - Intergenic
1107406119 13:40115378-40115400 CTGAAGTTTCATTTGGAGCCTGG + Intergenic
1108767562 13:53651170-53651192 GTGCTTCCTCCTTTGGAGCCTGG + Intergenic
1110947660 13:81443554-81443576 CTGCATTCTCATCTGGAGGCAGG + Intergenic
1111313843 13:86525538-86525560 CTGCATCTTGATTTGGGTACTGG + Intergenic
1112297333 13:98199582-98199604 CTGCATCCTCATTATGGGCCAGG + Intronic
1113440086 13:110322173-110322195 CTGCTCCTTCATCTGGAGCTGGG - Intronic
1113533332 13:111045273-111045295 CTGCATCTACATCTGCAGCCAGG + Intergenic
1114258011 14:21018765-21018787 CTGCATCTTCATGAGGTGCTTGG + Exonic
1114584266 14:23795449-23795471 CTCCATCTTGAATAGGAGCCGGG - Intergenic
1114844191 14:26301192-26301214 CTGCATCTTCATGTGGTGGAAGG - Intergenic
1116916581 14:50532044-50532066 CTCCATCTTCACTTAGGGCCCGG + Exonic
1117703367 14:58437751-58437773 CTGCATCTTAATTTCCAGCTTGG - Intronic
1117996301 14:61481300-61481322 CAGCAGCTCCACTTGGAGCCTGG - Intronic
1119865666 14:77971422-77971444 CTACATTTTCATTTGGAGCTCGG - Intergenic
1120840369 14:89080233-89080255 CTGCATCTTGGTCTGGATCCTGG + Intergenic
1120959687 14:90113481-90113503 CACCATCTTCAATTGGATCCTGG + Intronic
1121733235 14:96201044-96201066 CTGCATTTTCATTTGGGGAAGGG + Intergenic
1123101788 14:105807899-105807921 ATGCACCTTCATTTTGAGCCAGG - Intergenic
1124552030 15:30690396-30690418 CTGCAGCTTCAGATGGCGCCTGG - Intronic
1124589156 15:31037824-31037846 CAGCATCTGCATTTGCATCCTGG + Exonic
1124679213 15:31715276-31715298 CTGCAGCTTCAGATGGCGCCTGG + Intronic
1125635232 15:41182367-41182389 ATGCATCTTCAGATTGAGCCCGG - Intergenic
1125895989 15:43302068-43302090 CTCCATCTGCATTTGGACCTTGG - Intronic
1126680470 15:51197202-51197224 CTGCACCTGCATTTGTGGCCAGG + Intergenic
1130848097 15:87766425-87766447 ATGCATCATCAAATGGAGCCTGG + Intergenic
1130881782 15:88061649-88061671 CTGCTTCTTCATCTGGTGCCTGG + Intronic
1132083806 15:98890187-98890209 CTGCATCTTGAATAGGAGCTAGG + Intronic
1133047761 16:3098719-3098741 GAGCAGCTTAATTTGGAGCCCGG + Intronic
1133466719 16:6034497-6034519 CTGCATCTTCATATGGTGGAAGG + Intronic
1134386943 16:13782143-13782165 CTGCATTTTTATTTTGAGCTTGG - Intergenic
1135314670 16:21434422-21434444 CTCCATCTTAAATAGGAGCCGGG + Intronic
1135367593 16:21866702-21866724 CTCCATCTTAAATAGGAGCCGGG + Intronic
1135444221 16:22504460-22504482 CTCCATCTTAAATAGGAGCCGGG - Intronic
1136103169 16:28010324-28010346 CTGCCTCTGCATTTGGGGTCTGG - Intronic
1136311334 16:29413104-29413126 CTCCATCTTAAATAGGAGCCGGG + Intergenic
1136324782 16:29514897-29514919 CTCCATCTTAAATAGGAGCCAGG + Intergenic
1136439467 16:30254882-30254904 CTCCATCTTAAATAGGAGCCAGG + Intergenic
1138624148 16:58236050-58236072 CTGCTTCTTTTCTTGGAGCCAGG - Intronic
1139553816 16:67693201-67693223 CTGCATCTGCATATTTAGCCAGG + Intronic
1143585230 17:7847528-7847550 CTGCTTCTACACTTGCAGCCCGG + Exonic
1144473061 17:15561754-15561776 CTCCATCTTCAATAGGAGCTGGG + Intronic
1144923421 17:18782966-18782988 CTCCATCTTCAATAGGAGCTGGG - Intronic
1146466859 17:33093105-33093127 CTGCATTTTCATTTGGCACTGGG - Intronic
1149188354 17:54029124-54029146 CTGCAGCTTTATTTGAAGCCTGG - Intergenic
1151156367 17:72125965-72125987 CTGCATCTTCTCTTGGAGTGAGG + Exonic
1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG + Intergenic
1152099164 17:78291104-78291126 CTGCATCTTCATTTTGCACTGGG + Intergenic
1153309687 18:3666022-3666044 CTGCCTCTGCGGTTGGAGCCGGG - Intronic
1158607603 18:58909765-58909787 ATGCACTTTCATTTGGACCCAGG + Intronic
1159523236 18:69553732-69553754 CTGGATTTTCAATTGGAGTCTGG - Intronic
1159951133 18:74484784-74484806 CTTCAAATTCATATGGAGCCAGG + Intergenic
1161967037 19:7554675-7554697 CTGCATCCTCATTGTGGGCCTGG + Exonic
1166215537 19:41332145-41332167 CTGCCCCTACATTTGGAGCCTGG - Exonic
1166459137 19:42970658-42970680 CTGCATCTTGAATAGGAGCAGGG + Intronic
1166476085 19:43125925-43125947 CTGCATCTTGAATAGGAGCAGGG + Intronic
1168128606 19:54301923-54301945 CTGCACCCACATTGGGAGCCTGG + Intergenic
925186060 2:1847190-1847212 GCGCATCTTCATTTGCAGTCAGG + Intronic
925315567 2:2920250-2920272 CTGCATGTTCATCTGGCACCGGG + Intergenic
925670098 2:6302123-6302145 CAGCATCCTGATTTGAAGCCTGG + Intergenic
926292558 2:11542341-11542363 CTGCATCTGCTCTTGGAGCTTGG + Intronic
926640584 2:15231422-15231444 CTACATTATCATTTAGAGCCAGG + Intronic
926711458 2:15885362-15885384 CTGCATCTTGAATTAGAGCTTGG + Intergenic
928256803 2:29729674-29729696 CTGCCTCTGCCTTTAGAGCCAGG - Intronic
929318000 2:40504040-40504062 CTGCATTATAATTTGAAGCCAGG - Intronic
937153973 2:119705324-119705346 CTGCATTCTCATCTGGAGGCTGG + Intergenic
937465716 2:122131522-122131544 CTGCATCTTACCTTGGGGCCAGG - Intergenic
938238990 2:129728514-129728536 CTTCATCTTCAATAGGAGCTGGG - Intergenic
938303220 2:130230598-130230620 CTGCCTCTTCCTGTGGTGCCGGG + Intergenic
938453450 2:131443639-131443661 CTGCCTCTTCCTGTGGTGCCGGG - Intergenic
940726290 2:157340401-157340423 CTGCATCTTAAATAGGAGCTGGG - Intergenic
941066839 2:160913218-160913240 CTGCATTTGCATTTGTTGCCCGG + Intergenic
942148644 2:173052179-173052201 CAACATCTTGATTTGGAGCCTGG + Exonic
942589001 2:177520253-177520275 CTGCATCTTAAATAGGAGCTGGG - Intronic
947089544 2:226494892-226494914 CTGCATCTTCATTTCCAGCAGGG + Intergenic
947274796 2:228378350-228378372 CTGCATTGTCATCTGGAGCTTGG - Intergenic
947497354 2:230647608-230647630 CTCCGTCTTGATTAGGAGCCGGG + Intergenic
947605492 2:231483146-231483168 CTGCATTTTCATTTTGCGCCAGG + Intronic
1171437679 20:25135802-25135824 CCGCATCCTCATCTGGTGCCGGG + Intergenic
1173276465 20:41588521-41588543 CTGCCTCTTCATTTTGGGCATGG - Intronic
1174398777 20:50264640-50264662 CTGGATCTTCAGCTGGAGCCAGG - Intergenic
1174761440 20:53210583-53210605 CCTCATCTGCTTTTGGAGCCTGG + Intronic
1177255181 21:18652315-18652337 CTGCATCTTCATATGGTGGAAGG - Intergenic
1178392202 21:32207978-32208000 CTGCATTTTCATTTGGCACTGGG + Intergenic
1178550538 21:33534574-33534596 CTGCAGCTTCATTTTGAGGTAGG - Exonic
1181885139 22:26016027-26016049 CTGCATCTTCATGGGGAACTGGG + Intronic
1182027088 22:27128701-27128723 CTGCATTTTCATTTTGCACCAGG + Intergenic
1183092606 22:35533125-35533147 CTGCCTCTCCAGCTGGAGCCTGG + Intergenic
949405172 3:3706391-3706413 CTGCATCTTGAATAGGAGCTGGG - Intronic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
951074916 3:18378701-18378723 CTGTATCTTCACTGGGTGCCCGG + Intronic
951822865 3:26832997-26833019 CTGCATTTTCATCTGGAGTTCGG - Intergenic
952737487 3:36704920-36704942 CTGCATCTTCATCGGGAATCAGG - Intergenic
953820486 3:46203833-46203855 CAGCATCATCATTTGGGCCCTGG - Exonic
954938020 3:54344754-54344776 CTCCATCTTAATTAGGAGCTGGG + Intronic
955045864 3:55359092-55359114 CTGCATCTTGAATAGGAGCTGGG + Intergenic
955068752 3:55554853-55554875 CTGCATCCTCTCTTGGGGCCTGG - Intronic
955348656 3:58178790-58178812 CCTCATCTACATTTTGAGCCTGG + Intergenic
955693014 3:61608445-61608467 CTGCATCTTTCCTTGAAGCCTGG + Intronic
955813907 3:62821706-62821728 CTGTGTCATCATTTGGAGACAGG - Intronic
956070361 3:65443314-65443336 CTGCATTTTCATTAGGAACAAGG - Intronic
956134071 3:66081840-66081862 CTGCATCCTCATGTGGGGCTTGG - Intergenic
956648547 3:71481429-71481451 CTACATCTTAACTTGGATCCTGG + Intronic
957889161 3:86332733-86332755 TTGCATTTTCATTTGGAGTTTGG + Intergenic
959192179 3:103128588-103128610 TAGCATCTTCCTTTGGAGCAAGG + Intergenic
959467661 3:106709261-106709283 CTGCAACTTTATTTGGAACCAGG - Intergenic
959886674 3:111510451-111510473 CTGCATCTTCACATGGAGGAAGG + Intronic
960511603 3:118555839-118555861 CAGCATCTTCATTTGGCTACAGG - Intergenic
962197862 3:133379369-133379391 CTGCCTCTTCCTCTGCAGCCAGG - Intronic
962738053 3:138343462-138343484 CTCCAGCTTCATTAGGAGCTAGG - Intergenic
962976623 3:140451534-140451556 CTGCCTCTACATTAGAAGCCTGG + Intronic
963710476 3:148741479-148741501 CTGCATCATCATTTGGCTGCTGG + Exonic
965500213 3:169446819-169446841 CTGCATAGTCATTAGGAGCATGG - Intronic
966034916 3:175399803-175399825 CTGCATCTTCAACAGGAGCCGGG - Intronic
967406937 3:189127035-189127057 CTGCATCTTCCCTTTGAGACAGG + Intronic
968081411 3:195849155-195849177 CTGCATCTTGAATGGGAGCTGGG - Intergenic
971252420 4:24984533-24984555 CTGCATTTTCATTTTGTCCCAGG + Intergenic
971299492 4:25430078-25430100 CTGCATTTTCATTTTAAGCTGGG + Intergenic
971971815 4:33630825-33630847 CTGTGTCCTCATCTGGAGCCTGG + Intergenic
972927657 4:44031367-44031389 CTGCATTCTCATCTGGAGCTTGG - Intergenic
976199485 4:82564054-82564076 TTTCATTTTCATTTAGAGCCAGG + Intergenic
976624271 4:87162346-87162368 CTACATATTGATTTGAAGCCAGG - Exonic
976790116 4:88868977-88868999 CAGCATCTTCATTTGGAAGATGG + Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977373516 4:96170602-96170624 CTGCATTTTCATTTTGTGCTGGG + Intergenic
977430381 4:96925324-96925346 CAGCATCTTCTTCTGAAGCCGGG - Intergenic
981158343 4:141467079-141467101 CTGCATCTACGTATGGAGCTAGG + Intergenic
982556967 4:156879353-156879375 CTGCATCTGCCTTTGCAGTCTGG - Intronic
988300938 5:29425928-29425950 CTGCATCTTTATTTTGATGCTGG + Intergenic
989960175 5:50403917-50403939 TTTCATCTTCATTTCTAGCCTGG - Intronic
992865846 5:80956492-80956514 CTCCATCTTAAATAGGAGCCGGG - Intergenic
996574047 5:124962941-124962963 CTGCCTCTTCCTGTGGAACCTGG + Intergenic
1004767332 6:18745014-18745036 CTGCATTCTCATCTGGAGCTGGG - Intergenic
1005297600 6:24441810-24441832 CTGCATTTTTATTTGGAACTGGG + Intronic
1005955637 6:30661543-30661565 CTGTTTCTTCTTTTGGAGACAGG + Intronic
1006010559 6:31039645-31039667 CTGCATCCTCATCTGGAGGCTGG + Intergenic
1007168229 6:39843568-39843590 CTGCATTTTCATTTTGTGCTGGG - Intronic
1007749264 6:44062211-44062233 CTGCACCTTCACCTGGAGCAGGG + Intergenic
1008794571 6:55287104-55287126 CAGCATCTTCATTTTTATCCAGG + Intergenic
1009004178 6:57761835-57761857 CTGCATCTTTATTTTGATGCTGG + Intergenic
1011897814 6:92253784-92253806 CTGCAACTTCATCTGGAGCTTGG + Intergenic
1012502032 6:99898774-99898796 CTGCATTCTCATCTGAAGCCTGG + Intergenic
1014220539 6:118794713-118794735 CTGCCTCTTCATATGGAGAAAGG - Intergenic
1015133045 6:129835834-129835856 CTGCATCTTGATGTGGAGATGGG + Intronic
1015985061 6:138876207-138876229 CTCCCTCTTCCTTGGGAGCCAGG - Intronic
1017893792 6:158661305-158661327 CTGCCTGTTCATCTGGAACCTGG + Exonic
1018719969 6:166565097-166565119 CTGCATCTTCCTGTTGAGTCTGG + Intronic
1018943926 6:168332103-168332125 CTCCATCTTCGTTTGGTTCCCGG + Intergenic
1019151097 6:170006391-170006413 CTGCATTTTCATTTTGCACCAGG + Intergenic
1020448055 7:8290898-8290920 TTGCCTCTTGATTTGCAGCCAGG + Intergenic
1021198487 7:17698908-17698930 ATGCAAGTTTATTTGGAGCCAGG - Intergenic
1021976724 7:26018370-26018392 CTGAATCTTCATTTGAATGCAGG + Intergenic
1022016092 7:26349700-26349722 CTGCCTTTCCATTTGGAGTCTGG - Intronic
1023700770 7:42889998-42890020 TTGCATATTCATTTGTAGCATGG + Intergenic
1026154895 7:67818215-67818237 GTGCAACTACATTTGGAGACAGG - Intergenic
1026248142 7:68641473-68641495 CTGGAGCTTCATTTGAACCCAGG - Intergenic
1030123121 7:106130048-106130070 CTCCATCTTCAATAGGAGCTGGG + Intergenic
1030157044 7:106465835-106465857 GTGCTTCTTCATTTAGACCCAGG - Intergenic
1030938219 7:115613383-115613405 GTGCAGCTGCATTTGTAGCCTGG - Intergenic
1030985239 7:116233839-116233861 CTGCATCTTCACATGGAGGAAGG + Intronic
1035443619 7:158924265-158924287 CGGCATCTTCCTGTGGAGCTAGG - Intronic
1036101536 8:5792389-5792411 CTCCATCTTAATTAGGAGCAGGG + Intergenic
1038459750 8:27705709-27705731 CTACAACTTCCTTTGGAGCAGGG - Intergenic
1038718974 8:30016210-30016232 CCACAGCTTCCTTTGGAGCCCGG - Intergenic
1039151495 8:34511892-34511914 TTACCTCTTCATTTGGAGCAAGG - Intergenic
1042474684 8:69233783-69233805 CTGCATCTTTATATGGAGTAAGG + Intergenic
1042664052 8:71187043-71187065 TTGTATATTCATTTGGAGGCAGG + Intergenic
1042670674 8:71259570-71259592 CTACATTGTCATTTGAAGCCAGG - Intronic
1042892917 8:73633298-73633320 CTCTATCTTCATTTGAAACCTGG - Intronic
1043492658 8:80764621-80764643 CTGCATTTACATTTGGAGAGTGG + Intronic
1044595714 8:93956357-93956379 CTGGCTCTGCATTTGTAGCCCGG + Intergenic
1044958546 8:97506500-97506522 CTGCATCTTCATCTGCTGGCAGG - Intergenic
1045738773 8:105328882-105328904 CTGAGTCTTCATTTGGAGGTGGG - Intronic
1046368205 8:113265417-113265439 CTCCAGCTTCATTTCTAGCCAGG - Intronic
1047328991 8:123867870-123867892 CTGCATCTTGATCTGGATGCTGG - Intronic
1047420299 8:124702517-124702539 CTTCAGCTTTGTTTGGAGCCTGG - Intronic
1047934050 8:129758949-129758971 CTGCAGTTTAATTTGGAGTCAGG - Intronic
1051493979 9:17698171-17698193 CTGCATCTGGACTTGAAGCCAGG - Intronic
1052198423 9:25746702-25746724 ATGTATCTTTATTTGGAGGCAGG + Intergenic
1052526542 9:29626480-29626502 CTGCATCTCCATTTCTAGACTGG - Intergenic
1054941582 9:70748643-70748665 CTGCATCTTCATGTGGTGGAGGG - Intronic
1055320132 9:75075368-75075390 TTGCATCTTGAGTTGCAGCCAGG - Intronic
1056054859 9:82811030-82811052 CTCCATCTTGATTAGGAGCTGGG + Intergenic
1057271500 9:93654133-93654155 TTGCAGCTTTATTTGCAGCCTGG + Intronic
1057826984 9:98378803-98378825 CTGCTTCTTGATATGGATCCTGG + Intronic
1058450445 9:105091430-105091452 CTGAACCTTGATCTGGAGCCCGG - Intergenic
1058693636 9:107540390-107540412 TGGCATGTTCACTTGGAGCCAGG + Intergenic
1059557317 9:115294385-115294407 CTGCATCCTCACCTGGATCCCGG + Intronic
1060517441 9:124274811-124274833 CTGCATGTCCATTTGTAGCAAGG + Intronic
1060821400 9:126663626-126663648 CTGCATAGTCATTAGGCGCCAGG - Intronic
1061594980 9:131623104-131623126 TTGCCTCTTCGTCTGGAGCCTGG - Intronic
1186185710 X:7017789-7017811 CTGCATCTTGAATAGGAGCAGGG + Intergenic
1186635069 X:11394893-11394915 CTGCATTTTCATTTTGATCAGGG - Intronic
1186670809 X:11765452-11765474 CTCCATCTTCCCTAGGAGCCAGG + Exonic
1186877503 X:13830851-13830873 CTGCATTTTCATTTTGTACCTGG + Intronic
1189632543 X:42970083-42970105 TTGCATCACCATTTGGAGCAGGG + Intergenic
1189730798 X:44018457-44018479 CTGCATTTTCATTTTGCACCGGG - Intergenic
1192230908 X:69264354-69264376 CCGCATCTGCATATGGAGTCAGG - Intergenic
1194668371 X:96700467-96700489 CTGCATCTGCATCTGCATCCAGG - Intronic
1194743171 X:97599774-97599796 ATGCATCTTGATTTGGAGAGAGG + Exonic
1195247933 X:103013327-103013349 CTGCATTCTCATTTGGAACTTGG + Intergenic
1196754263 X:119144111-119144133 TTGCTCCTTCATTAGGAGCCTGG + Intronic
1197025266 X:121740290-121740312 CTGCATCTGGATTTGGAGACAGG + Intergenic
1198071337 X:133151498-133151520 CTACATATTCACTTGGAGCCAGG - Intergenic
1198792769 X:140363485-140363507 CTGCATTCTCATCTGGAGCTTGG - Intergenic
1200167565 X:154047797-154047819 CTGCATTTTCATTTTGCACCAGG - Intronic
1201505601 Y:14696065-14696087 CTGCATCTTCATGTCCAGCAGGG + Intronic