ID: 950765572

View in Genome Browser
Species Human (GRCh38)
Location 3:15270586-15270608
Sequence GGGGGCAGCTCTAGACGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950765572_950765578 25 Left 950765572 3:15270586-15270608 CCACCACGTCTAGAGCTGCCCCC 0: 1
1: 0
2: 2
3: 11
4: 152
Right 950765578 3:15270634-15270656 AAATGTGATTAATCCCAGCCAGG 0: 2
1: 0
2: 6
3: 9
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950765572 Original CRISPR GGGGGCAGCTCTAGACGTGG TGG (reversed) Intronic