ID: 950766052

View in Genome Browser
Species Human (GRCh38)
Location 3:15273884-15273906
Sequence ATGTGATTATATTAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3393
Summary {0: 1, 1: 6, 2: 120, 3: 666, 4: 2600}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950766045_950766052 8 Left 950766045 3:15273853-15273875 CCAAATTTACATATTGAAGCCCT 0: 2
1: 13
2: 118
3: 522
4: 1278
Right 950766052 3:15273884-15273906 ATGTGATTATATTAGGAAGTGGG 0: 1
1: 6
2: 120
3: 666
4: 2600
950766043_950766052 12 Left 950766043 3:15273849-15273871 CCACCCAAATTTACATATTGAAG 0: 1
1: 11
2: 86
3: 580
4: 1910
Right 950766052 3:15273884-15273906 ATGTGATTATATTAGGAAGTGGG 0: 1
1: 6
2: 120
3: 666
4: 2600
950766044_950766052 9 Left 950766044 3:15273852-15273874 CCCAAATTTACATATTGAAGCCC 0: 4
1: 21
2: 225
3: 936
4: 2277
Right 950766052 3:15273884-15273906 ATGTGATTATATTAGGAAGTGGG 0: 1
1: 6
2: 120
3: 666
4: 2600
950766042_950766052 13 Left 950766042 3:15273848-15273870 CCCACCCAAATTTACATATTGAA 0: 1
1: 1
2: 35
3: 258
4: 1547
Right 950766052 3:15273884-15273906 ATGTGATTATATTAGGAAGTGGG 0: 1
1: 6
2: 120
3: 666
4: 2600

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950766052 Original CRISPR ATGTGATTATATTAGGAAGT GGG Intronic
Too many off-targets to display for this crispr