ID: 950767990

View in Genome Browser
Species Human (GRCh38)
Location 3:15288150-15288172
Sequence GGTCTGAATAGAGCAAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 11, 3: 62, 4: 244}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950767990_950767993 -4 Left 950767990 3:15288150-15288172 CCCTCTTTTGCTCTATTCAGACC 0: 1
1: 0
2: 11
3: 62
4: 244
Right 950767993 3:15288169-15288191 GACCTTTAACTGATTGGATGAGG 0: 6
1: 61
2: 298
3: 711
4: 993
950767990_950767992 -10 Left 950767990 3:15288150-15288172 CCCTCTTTTGCTCTATTCAGACC 0: 1
1: 0
2: 11
3: 62
4: 244
Right 950767992 3:15288163-15288185 TATTCAGACCTTTAACTGATTGG 0: 2
1: 23
2: 156
3: 409
4: 891
950767990_950767995 10 Left 950767990 3:15288150-15288172 CCCTCTTTTGCTCTATTCAGACC 0: 1
1: 0
2: 11
3: 62
4: 244
Right 950767995 3:15288183-15288205 TGGATGAGGACCACCCACACTGG 0: 1
1: 15
2: 114
3: 234
4: 603
950767990_950768002 23 Left 950767990 3:15288150-15288172 CCCTCTTTTGCTCTATTCAGACC 0: 1
1: 0
2: 11
3: 62
4: 244
Right 950768002 3:15288196-15288218 CCCACACTGGGGAGGGCAATCGG 0: 1
1: 1
2: 7
3: 29
4: 225
950767990_950767996 11 Left 950767990 3:15288150-15288172 CCCTCTTTTGCTCTATTCAGACC 0: 1
1: 0
2: 11
3: 62
4: 244
Right 950767996 3:15288184-15288206 GGATGAGGACCACCCACACTGGG 0: 1
1: 15
2: 121
3: 317
4: 702
950767990_950767998 15 Left 950767990 3:15288150-15288172 CCCTCTTTTGCTCTATTCAGACC 0: 1
1: 0
2: 11
3: 62
4: 244
Right 950767998 3:15288188-15288210 GAGGACCACCCACACTGGGGAGG 0: 1
1: 16
2: 77
3: 225
4: 727
950767990_950767999 16 Left 950767990 3:15288150-15288172 CCCTCTTTTGCTCTATTCAGACC 0: 1
1: 0
2: 11
3: 62
4: 244
Right 950767999 3:15288189-15288211 AGGACCACCCACACTGGGGAGGG 0: 1
1: 15
2: 85
3: 230
4: 823
950767990_950767997 12 Left 950767990 3:15288150-15288172 CCCTCTTTTGCTCTATTCAGACC 0: 1
1: 0
2: 11
3: 62
4: 244
Right 950767997 3:15288185-15288207 GATGAGGACCACCCACACTGGGG 0: 1
1: 10
2: 105
3: 435
4: 1395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950767990 Original CRISPR GGTCTGAATAGAGCAAAAGA GGG (reversed) Intronic
901125183 1:6924176-6924198 GGTGTGAATAGTGCACAAGAGGG + Intronic
902081886 1:13826893-13826915 GACCTGGATAGAGCAAAAGGTGG - Intergenic
902674731 1:18000881-18000903 GCTATGCACAGAGCAAAAGAGGG + Intergenic
903467041 1:23559017-23559039 TGTCTGATTAGAGGAAAAGAGGG + Exonic
905049381 1:35036681-35036703 GGCCAGAATAGAACAAAAGGTGG + Intergenic
905894478 1:41536146-41536168 ACTCTGAATATAACAAAAGATGG + Intronic
907663059 1:56411364-56411386 GGTCTGACTTGAGGGAAAGATGG - Intergenic
908036699 1:60062137-60062159 GGTCTGAAGAGAGGAGAGGAGGG - Intronic
908825047 1:68125097-68125119 AGTCTGAATAGGGCAGAGGACGG + Intronic
909238812 1:73185321-73185343 GGTCTGAATAGAACAAAATGTGG + Intergenic
909387457 1:75075482-75075504 GTTCTGAATAGAGAAACAAAAGG + Intergenic
910141837 1:84034615-84034637 GGTCTGTATAGAACAAAAGGAGG + Intergenic
910486754 1:87723420-87723442 GGCCTCAATAGAGCAAAAGGTGG + Intergenic
910678262 1:89836831-89836853 GGTGTGAAGAGGGCAAATGAGGG - Intronic
912069463 1:105790932-105790954 GGCCTGAATAGAATAAAACATGG - Intergenic
913222477 1:116670162-116670184 GGTAAGAATAGAGCATCAGATGG + Intergenic
913390427 1:118304956-118304978 GTACTGAATAAAGCCAAAGAAGG + Intergenic
914228547 1:145743262-145743284 GGTCTGAATAGAACAAGTAAGGG + Exonic
915469398 1:156116453-156116475 GGTCTGCATAGAGAAAGGGAAGG - Intronic
916327392 1:163578294-163578316 GGCCTGAATAGAACAAAAGGTGG + Intergenic
916576750 1:166073843-166073865 GGTGTGGAAAGAGCCAAAGATGG - Intronic
917708712 1:177661179-177661201 GGATGGAATAGAGCTAAAGAAGG + Intergenic
918733880 1:188033817-188033839 GCTCTGAATAGACCAAAAACAGG - Intergenic
918804012 1:189015828-189015850 GGACTGAATAAAGCAAATGAGGG - Intergenic
920927007 1:210351256-210351278 GGTCTAAATAGAACAAAAGGAGG - Intronic
921948329 1:220904344-220904366 GGTCAGAAAAGAGCAAAGAATGG + Intergenic
922204032 1:223431137-223431159 GGCCTGAATAGAGCAAATAGTGG + Intergenic
923504243 1:234591773-234591795 AGTCTGAATATAGAAACAGAAGG - Intergenic
924295549 1:242583893-242583915 GATCTGAATACAGCAAGAGATGG - Intergenic
924724671 1:246658235-246658257 AGTTTGTAAAGAGCAAAAGATGG - Intronic
924903804 1:248430707-248430729 GGTCTTAATAGTTCAACAGATGG + Intergenic
924924066 1:248661297-248661319 GGTCTTAATAGTTCAATAGATGG - Intergenic
1062922412 10:1290107-1290129 GATCTGTATAGAGCAAAAGCAGG + Intronic
1063893158 10:10651141-10651163 GGTCTGAAAAGCGCAAAATTCGG - Intergenic
1063906207 10:10782733-10782755 GGTCACAAGAGAGCAAAGGAAGG - Intergenic
1064259012 10:13769739-13769761 GGCTTGAATAGAACAAAAGATGG + Intronic
1065867334 10:29925506-29925528 GGTCTGAATGGAGCATAAAGCGG + Intergenic
1067022465 10:42813252-42813274 GGTCTAAATAAACCAAAAGACGG - Intronic
1067178856 10:43970132-43970154 GGTCTGAAAAGAGCAAGGGCTGG + Intergenic
1069878470 10:71577449-71577471 GGTCTGAATAAAGGAGAACATGG - Intronic
1070744025 10:78921899-78921921 TGTATGAATAGGGCAAAATAGGG - Intergenic
1072684803 10:97529808-97529830 GGTCAGAATGAAGCCAAAGAAGG - Intronic
1073031378 10:100529086-100529108 GCTCTGGATAGAGCCAAGGAAGG + Intronic
1073195831 10:101690888-101690910 AGTCTGTATATAGCAAAAGTGGG - Intronic
1074005008 10:109412872-109412894 GGTATGAATAGTCCAAAGGATGG - Intergenic
1074590315 10:114806611-114806633 GTAGAGAATAGAGCAAAAGAAGG + Intergenic
1075270733 10:121047899-121047921 AGCCTGGATAGAACAAAAGAAGG - Intergenic
1080936514 11:36869411-36869433 GGCCTGAATAGAGCAAAATTTGG + Intergenic
1081270697 11:41078791-41078813 GGACTGCATAGAGCACATGAAGG - Intronic
1083698433 11:64457866-64457888 GGTCTGAATGGTGCAAAGGGTGG + Intergenic
1086477941 11:87199604-87199626 GGTCTGAGTAAAGGAGAAGATGG + Intronic
1087196380 11:95308184-95308206 AGTCTGAATAGGGCAAAAGGTGG + Intergenic
1087366444 11:97225805-97225827 TGTTAGAAAAGAGCAAAAGAGGG + Intergenic
1087461183 11:98450335-98450357 GGCCTGAATAGAACAAAAGGTGG - Intergenic
1087658467 11:100956018-100956040 GGTCTGAGAAGAGGACAAGATGG - Intronic
1089164445 11:116464316-116464338 GGCCTGAATAGAACAAAAGGTGG + Intergenic
1089280578 11:117371505-117371527 GGGCTGAACAGAGCAGCAGAGGG - Intronic
1089568205 11:119383874-119383896 GCTCTGAAGAGAGCAGAAGCGGG + Intergenic
1090575412 11:128096770-128096792 GGACTGAATAGAACAAAAGAGGG + Intergenic
1092021037 12:5202344-5202366 GCTCTGAAAATAGAAAAAGATGG + Intergenic
1092667206 12:10815956-10815978 GAGCTGAAGATAGCAAAAGAGGG + Intergenic
1092749981 12:11709755-11709777 GGCCTGAATAGAACCGAAGAGGG + Intronic
1094221376 12:27997285-27997307 AGACTGAATGGAGCAAAAGAGGG - Intergenic
1095473890 12:42565725-42565747 GGTTTAAAAAGAGAAAAAGAAGG - Intronic
1098373496 12:69785618-69785640 GGCCTGAATAGAACAAAAAAGGG - Intronic
1098744237 12:74215449-74215471 GGTCTGAGAAGAGGAAAAGAGGG + Intergenic
1099485294 12:83222531-83222553 GGCCTGAATAGAACAAAAGATGG - Intergenic
1101550878 12:105760471-105760493 GGCCTGAATAGAACAAAAGGTGG - Intergenic
1102442418 12:112973892-112973914 GGCCTGAATAGAACAAAAAGAGG - Intergenic
1102613053 12:114129373-114129395 GGTGTAAATAGAGCTAAATAGGG + Intergenic
1104152900 12:126101844-126101866 GGTTTGAATTTAGCAAAATAGGG + Intergenic
1104566440 12:129889101-129889123 TGTCTGAATAGAACACAGGAAGG + Intronic
1105783434 13:23724302-23724324 GGCCTGAATGGAACAAAAGGTGG - Intergenic
1106546294 13:30733737-30733759 GGCCTGAATAGAACAAAAAGCGG + Intronic
1106734243 13:32572947-32572969 GACCTGAATAGAACAAAAGATGG + Intergenic
1107204686 13:37769486-37769508 TCTCTGAATAGAGAAAGAGAAGG - Intronic
1107655127 13:42585076-42585098 TATCTGAATAGAGTAAGAGAAGG - Intronic
1108255227 13:48603286-48603308 GGCCTGAATAAAGCAAAATGTGG - Intergenic
1110187309 13:72690534-72690556 GGCCTGAAAAAAACAAAAGATGG - Intergenic
1110613390 13:77514122-77514144 GGTGTGATTAGAACAAAAGCAGG - Intergenic
1110747010 13:79065780-79065802 ACTCTGATTAGAGCAACAGAGGG + Intergenic
1111407617 13:87829686-87829708 TGTCTGAATATGGCAAACGAGGG + Intergenic
1114467528 14:22934105-22934127 GTTCTGAACATAGAAAAAGATGG + Intergenic
1114824419 14:26059510-26059532 AGTATGAAGAGAGAAAAAGAAGG + Intergenic
1116101076 14:40437161-40437183 GGCCTTAATAGAAAAAAAGAAGG - Intergenic
1116530430 14:45966075-45966097 GGTCTGAACAGAACAAAAGATGG - Intergenic
1116978126 14:51138545-51138567 GGCCTGAGTAGAACAAAAGGTGG - Intergenic
1117278699 14:54216378-54216400 AGTCTGAACACAGAAAAAGATGG + Intergenic
1117344646 14:54820210-54820232 AGACTGAACAGAGCAAAAGAGGG - Intergenic
1117614170 14:57516238-57516260 AGTCTGAATAGACCAATAGCAGG - Intergenic
1118131017 14:62963618-62963640 GGCCTGAATAGAAAAAGAGATGG - Intronic
1118228861 14:63929098-63929120 GGCCTCATTAGAACAAAAGATGG - Intronic
1118656345 14:67953964-67953986 AGTTTGAATAGAAGAAAAGAAGG + Intronic
1118692999 14:68358023-68358045 GGCCTGAGAAGAGGAAAAGATGG + Intronic
1120484349 14:85092266-85092288 GGTCTGAATGGAAAAAAAGTTGG + Intergenic
1120562262 14:86009837-86009859 GGCCTGACTAGAGCAAAAGGTGG - Intergenic
1121097996 14:91231271-91231293 GTTCTGAAGAGAGGAAAAAAGGG + Intergenic
1121445713 14:93977639-93977661 GGTCTGACTGGTGCTAAAGATGG + Intergenic
1122710841 14:103656515-103656537 TGAGTGAATAGAGCAGAAGAGGG + Intronic
1126905114 15:53356576-53356598 GGGCTGAATACAGCAAAAGGTGG + Intergenic
1127143345 15:55999402-55999424 GGACTGAAAAGAGTAAAACAAGG + Intergenic
1127896571 15:63305402-63305424 CATCTGAATACAGCAAAACACGG + Intronic
1128902829 15:71440970-71440992 GGTCTGAGAAGAGCCAAAGAAGG - Intronic
1130027641 15:80283528-80283550 GGCCTGAATAGAACAAAAGACGG + Intergenic
1131017841 15:89072470-89072492 GGTCTCAAAAGAGGAAAGGAGGG + Intergenic
1131302111 15:91208811-91208833 GTCCTGAATGGAGCAGAAGAAGG - Intronic
1131563555 15:93464914-93464936 GGCATGAATAGAACAAAAGGTGG - Intergenic
1132107695 15:99075436-99075458 GGCCTTAATAGAGAAAAAAAAGG + Intergenic
1133390507 16:5406326-5406348 GGTCTGAATAGAACAAAAGGTGG + Intergenic
1134570781 16:15289358-15289380 GACCTGAATAGAGCAAAAGTCGG - Intergenic
1134731599 16:16466717-16466739 GACCTGAATAGAGCAAAAGTCGG + Intergenic
1134935853 16:18245285-18245307 GACCTGAATAGAGCAAAAGTCGG - Intergenic
1135912775 16:26576733-26576755 GGTCTGAATAGAGCAAAAAGTGG - Intergenic
1135935633 16:26777477-26777499 GGGCTGAACAGAGAAACAGATGG - Intergenic
1138032477 16:53570775-53570797 GACCTGAATAGAACAAAAGGTGG + Intergenic
1139726221 16:68901321-68901343 GCTTTGAATAGTACAAAAGATGG - Intronic
1143269692 17:5666372-5666394 GGTCTCATAAGAGCAAGAGATGG - Intergenic
1144565260 17:16354103-16354125 GGTCTGAAAAAAGAAGAAGAAGG - Intergenic
1146100889 17:29980594-29980616 GGACTAAATAGAGAAACAGAAGG - Intronic
1147868816 17:43572688-43572710 GGTCTCACTAGAGCCTAAGAGGG - Intronic
1148485994 17:47991373-47991395 GGGATGAAGAGAGCAAAAGAGGG - Intergenic
1149590556 17:57826747-57826769 GGTCTTCATAGAGGAAAAAATGG + Intergenic
1150884494 17:69069709-69069731 GATCAGAATAAAACAAAAGAAGG - Intergenic
1152143879 17:78555819-78555841 GGCCTGAATAGCACAAAAGGCGG + Intronic
1155164188 18:23219329-23219351 TGTCTGATTAGAGCAGAGGAAGG + Intronic
1156759504 18:40570393-40570415 GGTCTTCATAAAGCAAAACAAGG + Intergenic
1157801621 18:50626094-50626116 GGCCTTAATAGAACAAATGAAGG - Intronic
1158821009 18:61158831-61158853 GGCCTGAATAGAAGAAAAGGTGG - Intergenic
1162880118 19:13652527-13652549 GGCCTGAGTAGAACAAAAGATGG - Intergenic
1167556424 19:50199033-50199055 AGTCTTACTAGAGCAAAAGGAGG - Intronic
1167842261 19:52131668-52131690 GGGCTGAATGGAGCAAAATCAGG + Intronic
926473135 2:13286355-13286377 GTTTTGAAGAGAGAAAAAGAAGG - Intergenic
926985080 2:18613644-18613666 GGTCTGAATAGACCAAAAAGGGG + Intergenic
928074422 2:28250043-28250065 GCTATGAATAGAGAATAAGAAGG + Intronic
928460956 2:31472127-31472149 GGCCTGAGTAGAGCAAAAGGTGG - Intergenic
929632126 2:43474171-43474193 CATATGGATAGAGCAAAAGAAGG + Intronic
929832179 2:45356112-45356134 CTTCTGACTAGAGCACAAGAAGG + Intergenic
931975632 2:67640982-67641004 GGTCTGAAGAGACCCAAAGCTGG - Intergenic
931982794 2:67712249-67712271 GGGCTGAATAGAACTAATGAAGG - Intergenic
932444373 2:71766198-71766220 GGTCTGAATAGAATAAAAGGTGG + Intergenic
933058580 2:77705346-77705368 AGACTGAATGGAGAAAAAGAAGG + Intergenic
936724767 2:115300223-115300245 GGGCTGAAGAGAGGAAAAAATGG - Intronic
937547491 2:123040478-123040500 GGCATTAATAGATCAAAAGAAGG + Intergenic
939100893 2:137893916-137893938 GATCTGCAAAGAGCCAAAGATGG - Intergenic
939472099 2:142635832-142635854 GGAAGGAATAGAGAAAAAGAAGG + Intergenic
940035525 2:149309010-149309032 TGTCTGAAAAGAGAACAAGATGG + Intergenic
941492982 2:166165287-166165309 GGCCTGAATAGAACAAAAGGTGG - Intergenic
941783966 2:169478501-169478523 GTTCTCTATAGAGCAATAGAAGG - Intergenic
942073647 2:172337338-172337360 GGTCTGCCGAGAGAAAAAGAGGG + Intergenic
943086140 2:183313684-183313706 GGCCTGAATAGACAAAAAGGTGG - Intergenic
943330070 2:186548593-186548615 AGTCTGAATAGAACAAAATGTGG + Intergenic
943538500 2:189182471-189182493 GGTCTAAAAAGAGCTAAAAAGGG - Intergenic
944652236 2:201842698-201842720 GCTCAGAATAGAGAAAAAGTAGG + Intronic
944977604 2:205073707-205073729 GGTGTGAATTGAACAAAATATGG - Intronic
945174889 2:207033426-207033448 GCTCAGAATAGAGCCAAAGTGGG - Intergenic
946806177 2:223473331-223473353 TTTCTGGATAGATCAAAAGACGG + Intergenic
947174246 2:227346569-227346591 TCTGTGAATACAGCAAAAGAAGG - Intronic
947329924 2:229017776-229017798 GTTCTCAATGGAGCAACAGATGG - Intronic
948704936 2:239784190-239784212 AGCCTGAATAGAACAAAAGGTGG - Intronic
1169266550 20:4170729-4170751 GGTATGGAGAGAGGAAAAGAGGG - Intronic
1169790739 20:9407724-9407746 GCTCTGAATAATGCAAAAGGAGG - Intronic
1170802788 20:19604198-19604220 GGTCTGAAGAGAGTAAAATAGGG + Intronic
1170810524 20:19670450-19670472 GGTTTGAATATTGCAACAGAAGG + Intronic
1172203994 20:33149017-33149039 AGTATAAATAGAGCAAATGATGG + Intergenic
1172917808 20:38456718-38456740 GGTCTGAACAAAGCAAATGAAGG + Intergenic
1173756643 20:45522451-45522473 GACCTGAATAAAGCAAAAGATGG - Intergenic
1173922329 20:46755637-46755659 GGTCAGAAGGAAGCAAAAGAAGG - Intergenic
1174102113 20:48135715-48135737 TGTCTAAAAAGAGCACAAGACGG - Intergenic
1174244099 20:49163299-49163321 GGTCTGACTAGAAAAAAAAAGGG - Intronic
1174877827 20:54246726-54246748 GCTCTGAATAGAACAAAAGGTGG - Intergenic
1174897256 20:54462786-54462808 GGTCTGAATTGAGCAGAAATTGG + Intergenic
1174911476 20:54612561-54612583 GGCCAGAATAGAACAAAAGGAGG + Intronic
1174931384 20:54819017-54819039 GGCCTGAATGGAACAAAAGGCGG + Intergenic
1174931429 20:54819622-54819644 GGCCTGAATGGAACAAAAGGAGG - Intergenic
1176410434 21:6446895-6446917 GGCCTGAATAGAACCAAAGGTGG + Intergenic
1177316192 21:19464230-19464252 GGCCTGAGCAGAGCAAAACATGG - Intergenic
1177682081 21:24384946-24384968 GGCCTGAATAGAACAAATGGTGG + Intergenic
1177957895 21:27623591-27623613 GGCCTGAATAAAGCAAAAGGTGG + Intergenic
1178110932 21:29369689-29369711 AGCCTGAACAGAACAAAAGATGG + Intronic
1178779532 21:35588304-35588326 GGTAAGAACAGACCAAAAGAAGG - Intronic
1179543945 21:42101841-42101863 GTTGTGAATAGGGCAAAGGAAGG + Intronic
1179637341 21:42721671-42721693 GGTCAGGAGAGAGCAAAAGTGGG + Intronic
1179685927 21:43055217-43055239 GGCCTGAATAGAACCAAAGGTGG + Intronic
1180632915 22:17242033-17242055 GGTATGAAGGGAGCACAAGAAGG + Intergenic
1181724463 22:24802190-24802212 GATCTGAATGGAACAAAAAAAGG - Intergenic
1181883630 22:26001392-26001414 GGTCTGAAGGGAGAAAAAGAGGG + Intronic
949585332 3:5431488-5431510 GGCCTGAATAGAACAAAAGGTGG + Intergenic
950767990 3:15288150-15288172 GGTCTGAATAGAGCAAAAGAGGG - Intronic
954580826 3:51702180-51702202 GGCCTGAAAAGAGCAAAGGAGGG - Intronic
956296548 3:67721003-67721025 GGTCTAAATACAGCAAATAAAGG - Intergenic
956394767 3:68813628-68813650 TGTCTGAATAGATCAACAAAAGG + Intronic
957124724 3:76143956-76143978 GGCCTGAATAGAAAAAAAAAAGG - Intronic
957262818 3:77922556-77922578 GGTATTAATAGAAGAAAAGAAGG + Intergenic
957307215 3:78473051-78473073 GGTCTGATTAGAGTATAAGATGG - Intergenic
957480612 3:80788735-80788757 GGCCTAAATAGAACAAAAGGTGG + Intergenic
958043050 3:88248970-88248992 GGCCTGAATAGAACAAAAAATGG + Intergenic
958185294 3:90111920-90111942 GGCCTGAATAGAACAAAAAGTGG + Intergenic
958996560 3:100912628-100912650 GGTCTGAATATAGCTAAATGTGG - Intronic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959984158 3:112554517-112554539 AGTCCGAAAAGAGCAAAGGATGG - Intronic
960661355 3:120063203-120063225 GATATGAATAGAGGAAAAGTGGG + Intronic
963930739 3:151001800-151001822 GGCCTGAAGAGAGCAAAGGGTGG - Intergenic
964388436 3:156173867-156173889 GACCTGAATAGAACAAAAGATGG + Intronic
965415408 3:168386732-168386754 AGTTTGTATAGAGAAAAAGAGGG - Intergenic
965464155 3:169006189-169006211 GGTCTGAATAGACCAATAACAGG - Intergenic
967475057 3:189906969-189906991 GGCCTGAAGAGAGCCAAAGGTGG - Intergenic
967606502 3:191452831-191452853 GGTCTGAATGGAACCAAAAATGG - Intergenic
968122545 3:196135860-196135882 GGTCTGAACAGTGCAGAGGATGG - Intergenic
970733950 4:19143593-19143615 GGTCCCAATAGAGGAAAGGATGG - Intergenic
973996431 4:56463954-56463976 GGCCTGAATAGAACAAAAAAGGG + Intergenic
976058542 4:81098650-81098672 GGTCTGAGTAGAGGGAGAGATGG + Intronic
976386540 4:84465911-84465933 GTTTTTAATAGAGCAAAAGAAGG + Intergenic
976387087 4:84473337-84473359 GGTCTGAAGAGAGACAAAAAAGG - Intergenic
977089178 4:92649419-92649441 GGTCTGAAAAGAAAAAAAAAAGG - Intronic
981159145 4:141476141-141476163 TGTATCAATAAAGCAAAAGAGGG - Intergenic
981396003 4:144250101-144250123 GGTAACAATAGAGCAAATGATGG - Intergenic
987989894 5:25197498-25197520 AGTCTTAAAAAAGCAAAAGAAGG - Intergenic
988050067 5:26016028-26016050 GGCCTGAACGGAACAAAAGAAGG + Intergenic
990369755 5:55105327-55105349 GGTCTACATAGAGTAAAAGCAGG + Intronic
991208091 5:64073072-64073094 GGGCTGAATAGTGAAAAGGAGGG + Intergenic
991538712 5:67703264-67703286 TGTCTGCATAGAGAAAAAGAGGG + Intergenic
991635209 5:68697769-68697791 GGACTGAATGGAGGAGAAGATGG - Intergenic
991970485 5:72136221-72136243 GGTGGGAATAGAGGAAATGAGGG - Intronic
993020976 5:82590393-82590415 AGTTTGAATACAGCAAATGAAGG + Intergenic
993083818 5:83338092-83338114 GGTGTGGAAAGAGCAATAGATGG + Intronic
993109888 5:83643794-83643816 GTTCTGAAGACAGCAAGAGAAGG + Intronic
993126646 5:83843982-83844004 CGTCTGAACAGAGCAAAAAAAGG + Intergenic
993392258 5:87334336-87334358 GGTCTGAACAGAACAAAAAATGG - Intronic
994346727 5:98696492-98696514 GGTCTGAATATACCTGAAGAAGG + Intergenic
995437694 5:112156496-112156518 GGCCTCAATAGAACAAAAAACGG - Intronic
996175132 5:120347166-120347188 GGCCTGAATAGAACAAAAAGAGG + Intergenic
996999647 5:129744331-129744353 GGTGAGAATCGACCAAAAGAGGG - Intergenic
997303292 5:132822049-132822071 TGGCTGACTAGAGCAGAAGAGGG - Intergenic
1001746807 5:174098609-174098631 GGTCTGAACAGAGCACACGAGGG - Intronic
1002290089 5:178194469-178194491 GGTCTGATTAGACCAAAGGCTGG + Intergenic
1002306207 5:178285518-178285540 AGTCTCAATAGAAGAAAAGATGG - Intronic
1004048436 6:12049053-12049075 GGTGAGAATACAGCAAAAGGTGG + Intronic
1004691966 6:17999894-17999916 GGTCTCAATAGAACAAAAAAAGG - Intergenic
1005723774 6:28629015-28629037 GGTCTGAATAGAACAGAAGGAGG - Intergenic
1008601472 6:53100286-53100308 TGTCCTAATAGAGCAAAGGAAGG - Exonic
1011002190 6:82603606-82603628 AGCCAGAATAGAACAAAAGATGG - Intergenic
1011522014 6:88218028-88218050 TGTCTGAATAGTGGATAAGATGG + Intergenic
1012027571 6:94017033-94017055 TGTCTGAAGACAGGAAAAGATGG - Intergenic
1012137357 6:95575445-95575467 GGTTTGAAAAGAGAGAAAGAAGG + Intergenic
1012322936 6:97874048-97874070 CTTGTGAATAAAGCAAAAGAAGG - Intergenic
1012902750 6:105026278-105026300 GCTCTGTAAAGAGCAGAAGAGGG - Exonic
1014162408 6:118185430-118185452 GGTAGGAATAGAGAAAAATAAGG + Intronic
1014400886 6:120988225-120988247 GGCCTGAATAGAATAAAAGGTGG - Intergenic
1014571921 6:123019968-123019990 AGTCTGAATAGAAAAAAAAAAGG - Intronic
1015189125 6:130454389-130454411 GGTTTGAGTAGAGATAAAGAGGG + Intergenic
1016709014 6:147147757-147147779 ACCCTGAATAGAACAAAAGATGG - Intergenic
1017657373 6:156642765-156642787 GGCCTGAATAGAGCAAAAGGCGG - Intergenic
1020355010 7:7266269-7266291 GGTCTCAATAGAACAAAAGGTGG + Intergenic
1020539266 7:9439838-9439860 TCTCTGAATAGAGCAATAAAAGG + Intergenic
1020854198 7:13396515-13396537 GGTGGGCATAGTGCAAAAGAAGG + Intergenic
1023178959 7:37461833-37461855 AGTCTGAGAAGAACAAAAGAAGG - Intergenic
1023687378 7:42750226-42750248 GGTAGAAAAAGAGCAAAAGAAGG - Intergenic
1024412520 7:49061921-49061943 TGCCTGAATAGAGCAAAAGGAGG - Intergenic
1025995636 7:66525621-66525643 GATCTGAATATGGAAAAAGATGG + Intergenic
1026987299 7:74562487-74562509 GATCTGAATATGGGAAAAGATGG + Intronic
1027654026 7:80906000-80906022 GGTGAGTAGAGAGCAAAAGAAGG + Intronic
1029264778 7:99329370-99329392 TGTCTTAATAGAGCTAGAGAGGG - Intronic
1029929091 7:104351883-104351905 GGTCTTAACAGAGAAAAACAGGG - Intronic
1030766243 7:113413337-113413359 GGTCTGAATAGAACAAAAGGTGG - Intergenic
1031181014 7:118415067-118415089 GATCAGAATAAAGCAAAATATGG - Intergenic
1032862915 7:135898560-135898582 GGCCTGAATAGAACAAATGGTGG - Intergenic
1032910498 7:136423578-136423600 GGTCTGACTAGTGCAGAACAAGG + Intergenic
1035521924 8:281759-281781 GGCCTGAATAGAGCAAAAGGTGG + Intergenic
1037384725 8:18326240-18326262 GGCCTGAATAGAACAAAAGGTGG - Intergenic
1037661377 8:20929748-20929770 GGCCTGAACAAATCAAAAGAAGG - Intergenic
1039282516 8:36001607-36001629 GGCTTAATTAGAGCAAAAGAAGG + Intergenic
1039384867 8:37126513-37126535 GGTCTGAATAGATCAAAAAGGGG - Intergenic
1039433799 8:37545894-37545916 GGTGTGAGTAGAACAAGAGAAGG - Intergenic
1039575500 8:38620507-38620529 GGCCTGAATAGAAGAAAAGGTGG + Intergenic
1041224216 8:55682791-55682813 GGCCTGAATAGGACAAAAGGTGG - Intergenic
1041262780 8:56036292-56036314 GGCCTGAACAGAGCAAAAGGTGG + Intergenic
1041295570 8:56353869-56353891 TCTCTGAATAGACCAAAAGCAGG - Intergenic
1041354619 8:56987416-56987438 AGTGTGAATAGAACAAAAGGAGG + Intronic
1041367497 8:57124220-57124242 GCTCTGAACAGAAGAAAAGAAGG + Intergenic
1041686395 8:60648896-60648918 GGTCTGAAGGAAGAAAAAGAGGG + Intergenic
1042472448 8:69206786-69206808 GGCCTGAATAGAGCAAAAGGTGG + Intergenic
1044557019 8:93574180-93574202 GGACTGAATTGTGCAAAATAAGG - Intergenic
1044605976 8:94047783-94047805 GGCCTAAATAGAACAAAAGGTGG + Intergenic
1045813345 8:106250488-106250510 GGCCTGAATAGAACAAAAAGTGG - Intergenic
1046185219 8:110705174-110705196 CGTTTAAATAGAGCAAAAAATGG + Intergenic
1046868994 8:119183639-119183661 GGACTGAAGAGAGGGAAAGAGGG - Intronic
1048034267 8:130662356-130662378 GGTGTGAATACAGGAAAGGAAGG - Intergenic
1048590523 8:135816891-135816913 GGCCTAAATAGAACAAAAGGAGG + Intergenic
1048795748 8:138148068-138148090 GGTCTGAATAAAGGAAGAAATGG - Intronic
1052989436 9:34510545-34510567 GGTAGGAATAAAGCAAAAGAGGG - Intronic
1054886513 9:70204777-70204799 GGTCTGAAAAGAGCAATATTCGG + Intronic
1057697424 9:97335128-97335150 GTTTTTAATAGAGCAAAAGAAGG - Intronic
1057901583 9:98953285-98953307 AGTTTGGATAGAGCAGAAGAAGG - Intronic
1058943400 9:109834883-109834905 GGGATGAATTGAGCGAAAGATGG - Intronic
1059636527 9:116176851-116176873 GGTCTGATTATAGCAAAACTGGG + Intronic
1061443456 9:130623258-130623280 GGTCTGAAAAGAGGAAAACATGG + Intronic
1062422678 9:136490925-136490947 CCTCTGGATAGAGCAAAGGAGGG - Intergenic
1187737939 X:22323470-22323492 GGTGCCAAGAGAGCAAAAGAAGG - Intergenic
1188051256 X:25489608-25489630 GGTCTAAATGGGGCAATAGAAGG + Intergenic
1190154595 X:47978705-47978727 ATTCTGAATATAGCAAAATATGG - Intronic
1190967291 X:55312939-55312961 TGTCTGGACAGAGGAAAAGAGGG + Intergenic
1191041470 X:56085490-56085512 AGCCTGAATAGAACAAAAGGTGG - Intergenic
1192785475 X:74330938-74330960 GTTCTGAATAAAGAAAAAGTAGG + Intergenic
1193227049 X:78995970-78995992 GAGCCGAATAGAGCAAAAAAAGG - Intergenic
1193350646 X:80460568-80460590 AACCTGAATAGAGCAAAAGCTGG + Intergenic
1193350681 X:80461448-80461470 AACCTGAATAGAGCAAAAGCTGG - Intergenic
1194155084 X:90378340-90378362 GGCCTAAATAGAACAAAAGGGGG - Intergenic
1194649791 X:96500907-96500929 GACCTGAATAGAACAAAAGGTGG + Intergenic
1194884049 X:99290534-99290556 GCTCTGAAGAGAACAAAAGAAGG - Intergenic
1194940505 X:100003934-100003956 GGTCAGAATGGAGAAAAACAGGG - Intergenic
1195654170 X:107319230-107319252 GGTTGGAACAGAGCAAAACAAGG + Intergenic
1196913150 X:120504962-120504984 GGCCTGAATAGAACAAGAGGTGG + Intergenic
1197555222 X:127944848-127944870 GGTCTGAAAAGAACTAAATATGG - Intergenic
1198468039 X:136921224-136921246 AGGCTGAATAGAACAAAAGTAGG - Intergenic
1199493215 X:148424113-148424135 GGTCTGAATAGAACAAAAGGTGG - Intergenic
1199816626 X:151403159-151403181 GCTCTGATTCCAGCAAAAGAGGG + Intronic
1200501436 Y:3955276-3955298 GGCCTAAATAGAACAAAAGGGGG - Intergenic
1201687038 Y:16716455-16716477 GGACTGAATAGAACAAAAAGTGG - Intergenic