ID: 950769546

View in Genome Browser
Species Human (GRCh38)
Location 3:15300721-15300743
Sequence ACAAGGTCCCTTGGGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 125}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950769535_950769546 20 Left 950769535 3:15300678-15300700 CCTCAGCCTTTGAACATCCTTCC 0: 1
1: 0
2: 2
3: 21
4: 223
Right 950769546 3:15300721-15300743 ACAAGGTCCCTTGGGGTTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 125
950769540_950769546 -7 Left 950769540 3:15300705-15300727 CCTTCGCTATTGACCAACAAGGT 0: 1
1: 0
2: 0
3: 3
4: 45
Right 950769546 3:15300721-15300743 ACAAGGTCCCTTGGGGTTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 125
950769533_950769546 25 Left 950769533 3:15300673-15300695 CCCTGCCTCAGCCTTTGAACATC 0: 1
1: 0
2: 4
3: 18
4: 285
Right 950769546 3:15300721-15300743 ACAAGGTCCCTTGGGGTTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 125
950769538_950769546 -1 Left 950769538 3:15300699-15300721 CCAGTTCCTTCGCTATTGACCAA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 950769546 3:15300721-15300743 ACAAGGTCCCTTGGGGTTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 125
950769534_950769546 24 Left 950769534 3:15300674-15300696 CCTGCCTCAGCCTTTGAACATCC 0: 1
1: 0
2: 7
3: 96
4: 1606
Right 950769546 3:15300721-15300743 ACAAGGTCCCTTGGGGTTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 125
950769536_950769546 14 Left 950769536 3:15300684-15300706 CCTTTGAACATCCTTCCAGTTCC 0: 1
1: 0
2: 1
3: 25
4: 207
Right 950769546 3:15300721-15300743 ACAAGGTCCCTTGGGGTTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 125
950769537_950769546 3 Left 950769537 3:15300695-15300717 CCTTCCAGTTCCTTCGCTATTGA 0: 1
1: 0
2: 0
3: 6
4: 111
Right 950769546 3:15300721-15300743 ACAAGGTCCCTTGGGGTTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950769546 Original CRISPR ACAAGGTCCCTTGGGGTTGA GGG Intronic
901077077 1:6561870-6561892 ACGAGGTCCAGTGGAGTTGAAGG + Intronic
903019800 1:20386087-20386109 GCCAAGTCCCCTGGGGTTGATGG - Intergenic
905281669 1:36853306-36853328 ACAAAGGCCCATGGGGTGGATGG - Intronic
911420789 1:97637909-97637931 ACAAGGTCTCTTTTGCTTGAAGG + Intronic
914446029 1:147751391-147751413 ACAAGGTCCCGAGTGGTTGAGGG + Intergenic
915268285 1:154733986-154734008 ACAAGGTGCCCTGGGGATGGAGG + Intronic
920134722 1:203760511-203760533 ACAAAGTCCCTTGGTGGGGATGG - Intergenic
921009947 1:211132031-211132053 ACAAGATGCCTTGGGTTTTAAGG - Intronic
921060483 1:211579877-211579899 ACAAGGTCTCCAGGGGTTGATGG - Intergenic
923037630 1:230295695-230295717 AAAAGGTACCTAGGAGTTGAGGG - Intergenic
1064329883 10:14383560-14383582 ACAAGGACTTTTAGGGTTGACGG + Intronic
1067938166 10:50628775-50628797 AAAAGGGCACTTGGGGATGATGG + Intergenic
1070554062 10:77514584-77514606 ACAGGGTCCCTTTGGCTTGTGGG - Intronic
1070793663 10:79204455-79204477 AGAAGGGCCCCTGGGGTTCAGGG - Intronic
1072991859 10:100203148-100203170 GTAAGGTCCCTTGAGGTGGATGG - Intronic
1076563728 10:131384141-131384163 ACAAGGTGTATTGGAGTTGAGGG + Intergenic
1076885289 10:133259264-133259286 CCAAGGGGCCTCGGGGTTGAAGG + Intergenic
1077077767 11:709056-709078 ACAAGGGCCCTGGGGGCAGAAGG - Intronic
1077907061 11:6542827-6542849 ACAAACTTCCTTGGGGGTGATGG - Intronic
1078867318 11:15310103-15310125 TCAGGGACCCCTGGGGTTGAAGG + Intergenic
1078929277 11:15901087-15901109 CTAAGGTTCCTTGGGGTGGAGGG - Intergenic
1084272084 11:68034347-68034369 ACAAGGTTCCGAGAGGTTGAGGG - Intronic
1088786808 11:113189648-113189670 ACATTGTGCCTTGGGGGTGAGGG + Intronic
1092204435 12:6606797-6606819 ACAAGGTCACTTGGGGGTGGGGG + Intronic
1092653941 12:10665089-10665111 TCAAGGTCACTTGGGGTTATGGG + Intronic
1094696822 12:32827951-32827973 AACAGGTCCTTAGGGGTTGAAGG + Intronic
1095638982 12:44465485-44465507 ACAAGGTGCCTTGGAGTCCATGG + Intergenic
1096743096 12:53708908-53708930 ACAGGGTTCCTTAGGGTAGATGG + Intronic
1097378321 12:58864132-58864154 AAAAGTTCCCTTGGTGTTGCAGG + Intergenic
1098539150 12:71632879-71632901 ACAAGATCGCTTTGGGGTGAGGG - Exonic
1102226286 12:111230477-111230499 ACAAGGTCCCCTGGTGATTATGG + Intronic
1102282190 12:111627153-111627175 ACAAGGTACCCTGGGGTGGGGGG - Intergenic
1102595693 12:113990950-113990972 ACCAGGTCCCTTGGGTTTGGTGG - Intergenic
1108576392 13:51795179-51795201 AGAAGGTCCCTTGGGCAGGAGGG - Intronic
1110143916 13:72166387-72166409 AGAAATTTCCTTGGGGTTGAGGG + Intergenic
1112159179 13:96850496-96850518 ACAAAGTACAATGGGGTTGATGG + Intergenic
1113297105 13:108970862-108970884 ACAAGAATTCTTGGGGTTGAAGG + Intronic
1114597302 14:23924519-23924541 TCAATGTCCCTTGGGATGGAGGG - Intergenic
1114833941 14:26180607-26180629 AAAATGTCCCTTGAGGCTGAAGG - Intergenic
1115147062 14:30238267-30238289 ATCAGCTCCCTTGGGGTTGCTGG - Intergenic
1119571136 14:75673795-75673817 ACAAGGATCCTTGGGGAGGAAGG - Intronic
1121253683 14:92516685-92516707 GCAGGGTCCCCTTGGGTTGAAGG + Intronic
1129267067 15:74399294-74399316 ACGAGGTTTCTTGGGGGTGATGG + Intergenic
1129800821 15:78412756-78412778 AAAAGGTTTTTTGGGGTTGAGGG - Intergenic
1130759677 15:86805624-86805646 ACATAGCCCCTTGGGGTTGGTGG + Intronic
1131271614 15:90950616-90950638 GTAAGGTCCCTTGGGATTGCGGG + Intronic
1133718749 16:8474616-8474638 ACAAGGTGGCTGGGGGTTGATGG - Intergenic
1134641428 16:15832222-15832244 AAAATGTCCTTTGGGGTTCATGG + Intronic
1135004874 16:18811431-18811453 CCAAGGACCCTTTGGGTTGCAGG - Intronic
1139909016 16:70385360-70385382 ATAAGGTTACCTGGGGTTGAGGG + Intronic
1141863770 16:86735844-86735866 GCAAGGTCCCATGGGGGTGCAGG + Intergenic
1141969891 16:87474108-87474130 ACCAGGTGCCTAGGGGATGAGGG - Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1143836878 17:9699939-9699961 ACAAGCTCCCATGGGAATGAGGG + Intronic
1144150399 17:12437656-12437678 ACAAGGTCCAGTGGGGGTGGGGG - Intergenic
1147051914 17:37801420-37801442 AGAAGGTCCCTGGGGGTGGGTGG + Intergenic
1147702065 17:42402562-42402584 ACAAGGTCCCTTGGTGCTGATGG - Exonic
1148785976 17:50146424-50146446 ACAAGGGCCCTTGGGGGAGATGG - Intronic
1149595923 17:57864668-57864690 TCAAGGACCCTTGGTGTTTAAGG + Intronic
1150816794 17:68398763-68398785 ACAACGTCCCTAGAGGTTGCTGG - Intronic
1156546420 18:37968119-37968141 TCTGGCTCCCTTGGGGTTGAAGG - Intergenic
1160281238 18:77492943-77492965 ACAAGGTCCACCTGGGTTGAAGG + Intergenic
1162525343 19:11203377-11203399 ACCAGGACCCTGGGGGTTGAGGG - Intronic
1163076351 19:14895485-14895507 ACATGCTACCTTGGGCTTGATGG - Intergenic
1166455266 19:42935369-42935391 ACATGGTCCCTGGGTGTTGGGGG - Intronic
925384501 2:3452635-3452657 TCAAGGTGCCTGGAGGTTGAAGG - Intronic
928091403 2:28377205-28377227 GCGAGGTCCCTTGGGGTGGGAGG + Intergenic
928523896 2:32119617-32119639 ACATGGTCCTATGGGATTGAAGG - Intronic
930753583 2:54954472-54954494 ACAAGGACCCTTGGGTAGGAAGG - Intronic
931504061 2:62904582-62904604 TCAAGGTCCCTTGGGGAATAAGG + Intronic
932717444 2:74111842-74111864 ACAATGTCCCTTGGGTTTGTGGG - Intergenic
933773644 2:85758983-85759005 TCAGGGTCCCTCAGGGTTGATGG + Intronic
936041694 2:109154712-109154734 ACAAGGTCTGTGGGGGGTGATGG + Intronic
938472909 2:131582205-131582227 ACAAGGTTCCTTGGCTTTGCTGG + Intergenic
942145787 2:173024926-173024948 GGATGGTCCCTTGGGGTGGAAGG - Intronic
942206741 2:173626586-173626608 AAAAGGTCCCTGGAGGTTGGCGG - Intergenic
947137736 2:226991983-226992005 ACAAGCTTCCTTGGGGTGGTAGG - Intronic
947712556 2:232324399-232324421 ACAAGGGCCCTGGTGGCTGAGGG + Intronic
947731520 2:232434079-232434101 ACAAGGGCCCTGGTGGCTGAGGG + Intergenic
948133659 2:235620065-235620087 AGAAGGTCCCTGGGGGCCGAGGG - Intronic
1170595651 20:17803848-17803870 ATAAGGTCACTAGGGGCTGAGGG - Intergenic
1171519922 20:25767928-25767950 ACAAGGTCTCTAGGGGTGGAGGG - Intronic
1171556997 20:26088565-26088587 ACAAGGTCTCTAGGGGTGGAGGG + Intergenic
1172689722 20:36782130-36782152 ACAAACTCTCCTGGGGTTGAGGG - Exonic
1174371993 20:50096850-50096872 ACAAGTTCCCCTGGAGTTGCTGG - Intronic
1175099267 20:56566790-56566812 CCAAGATCCCTTGGGGCTCATGG + Intergenic
1175267336 20:57710392-57710414 ACAAGGTCCCTGGGGGCTCAGGG + Intronic
1176654058 21:9574217-9574239 ACAAGGTCTCTAGGGGTGGAGGG - Intergenic
1180254128 21:46610998-46611020 AAAGGGTACCTTGGGCTTGAGGG - Intergenic
1180673227 22:17569627-17569649 ACAAGGCAGCTTGGGGGTGAGGG - Intronic
1181768795 22:25111333-25111355 TCACGGTCCCTCGGGGCTGATGG - Intronic
1183630663 22:39030666-39030688 ACATTGTCCCATGGAGTTGAAGG - Intronic
1183634119 22:39050758-39050780 ACATTGTCCCATGGAGTTGAAGG - Intronic
1183741415 22:39670555-39670577 ACAAGCTCATTTGGGGTAGATGG + Intronic
950769546 3:15300721-15300743 ACAAGGTCCCTTGGGGTTGAGGG + Intronic
955271068 3:57499975-57499997 ACAAGGTCCCTTGAGGAGGTAGG + Intronic
956575286 3:70745924-70745946 AGAAGTTCCCTTGAGGTTGGGGG + Intergenic
956800093 3:72749547-72749569 ACAAGGGCACTTGGGAATGATGG + Exonic
961125360 3:124412865-124412887 AGCAGGACCCTTGGGTTTGATGG + Intronic
961710227 3:128822832-128822854 ACAATGTCTGTTGGGGATGATGG + Intergenic
964396688 3:156253349-156253371 ACAAGGTCCTTTGGGCTCCAGGG + Intronic
966623397 3:181990629-181990651 TCATGGTCCCTTAGGGTAGAAGG + Intergenic
968938913 4:3627903-3627925 CCAAGGACACTTGTGGTTGAGGG + Intergenic
969445571 4:7243034-7243056 GCAGGGCCCCTGGGGGTTGAGGG + Intronic
977284348 4:95083696-95083718 ATAAGGTATCTTTGGGTTGAAGG - Intronic
978549604 4:109911279-109911301 ACAAGCTCCCTAGGAGATGACGG - Intergenic
983837386 4:172407680-172407702 ACAAGGTCCATTGAGTTTGTGGG + Intronic
986693324 5:10331649-10331671 ACAAAGTCGCTTGGAGGTGAAGG + Intergenic
988882483 5:35518234-35518256 ATAATGTCCCTTGTGGGTGAAGG + Intergenic
989995241 5:50821325-50821347 ACAACTTACCCTGGGGTTGAAGG - Exonic
994252174 5:97548889-97548911 AGAAGGTTGCTTGGGGTTCAAGG + Intergenic
995871489 5:116748184-116748206 ACATGCTTCCTTGGGGTTGGGGG - Intergenic
998274217 5:140736715-140736737 AAGAGGTCTCTTGAGGTTGAGGG - Intergenic
1001309268 5:170599054-170599076 ACAGGCTGCCGTGGGGTTGAGGG + Intronic
1005276203 6:24221300-24221322 ACGAGTCCCTTTGGGGTTGAGGG - Intronic
1011036228 6:82978498-82978520 ACAAGGCCCTTTGGGATTTAAGG - Intronic
1011696545 6:89918241-89918263 CTCAGGGCCCTTGGGGTTGAAGG + Intergenic
1011825737 6:91303362-91303384 ACAAGCTCCCTGGGGGCTGCTGG - Intergenic
1017462323 6:154663039-154663061 ACAAGAGCCCTTGGGTTGGAGGG - Intergenic
1020218356 7:6213610-6213632 TCAAGGCCCCTGGGGGTTGAAGG - Intronic
1020667317 7:11063467-11063489 GAAAATTCCCTTGGGGTTGAGGG + Intronic
1024864701 7:53891915-53891937 ACAAGGTCCATTTGGGTTATAGG - Intergenic
1028161521 7:87491549-87491571 CCAATGACACTTGGGGTTGAGGG + Intergenic
1038781143 8:30569180-30569202 ACATGGGCCCCTGGGGTTGATGG - Intronic
1040666154 8:49635937-49635959 ACAGGGACCCTTGGGGAAGAAGG + Intergenic
1043541718 8:81270611-81270633 ACAAGTTCCCTACAGGTTGAGGG - Intergenic
1043630629 8:82327190-82327212 CCAAGGTCCACTGGGGTTGAGGG - Intergenic
1043854199 8:85245810-85245832 ACATGGTCCCTCGGGGTGGAAGG - Exonic
1048343651 8:133559892-133559914 CCAAGGTGCCTGGGGATTGAGGG - Intronic
1051224414 9:14883904-14883926 ACAAGCTCCCTTGGGGAATATGG - Intronic
1054451830 9:65407417-65407439 CCAAGGACACTTGTGGTTGAGGG - Intergenic
1056100672 9:83297935-83297957 ACCCTGTCCCTTGGGGTTGTTGG - Intronic
1057147831 9:92770390-92770412 CCAAGGTCCCTTAGGGGTCAGGG + Intergenic
1057740971 9:97710956-97710978 ACATTGTACCTTGGGGGTGAAGG + Intergenic
1057790494 9:98121577-98121599 TCTGGGTCCCTTGGGGTGGAGGG + Exonic
1059743441 9:117177954-117177976 ACACGGGGCCTTGGAGTTGATGG - Intronic
1059927034 9:119219869-119219891 ACAAGGGCACTAGGGGATGAGGG + Intronic
1061544866 9:131298791-131298813 CCCAGGTCCCTCGGGGTTGGTGG - Intronic
1062213761 9:135378162-135378184 AGAAGGTCCCTCAGGGATGAGGG - Intergenic
1062724310 9:138062745-138062767 TCAAGGACCCTGGGGGTTGCTGG + Intronic
1203631777 Un_KI270750v1:77669-77691 ACAAGGTCTCTAGGGGTGGAGGG - Intergenic
1187399064 X:18943314-18943336 ACTAGTTCACTTGGGGGTGAGGG - Intronic
1198198489 X:134389516-134389538 ACCAGGTGCCTTGTGGTAGAGGG + Intronic
1198420892 X:136470074-136470096 AAAAGGTCCCTGGGAGTTCAGGG + Intergenic