ID: 950772440

View in Genome Browser
Species Human (GRCh38)
Location 3:15323249-15323271
Sequence AGTCCATCCCGCTGTAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950772436_950772440 13 Left 950772436 3:15323213-15323235 CCACAGCGCAACGCCCTGCTGAT 0: 1
1: 0
2: 0
3: 5
4: 102
Right 950772440 3:15323249-15323271 AGTCCATCCCGCTGTAATCCTGG 0: 1
1: 0
2: 0
3: 2
4: 63
950772437_950772440 0 Left 950772437 3:15323226-15323248 CCCTGCTGATCCAGTGACTACAA 0: 1
1: 0
2: 0
3: 3
4: 126
Right 950772440 3:15323249-15323271 AGTCCATCCCGCTGTAATCCTGG 0: 1
1: 0
2: 0
3: 2
4: 63
950772439_950772440 -10 Left 950772439 3:15323236-15323258 CCAGTGACTACAAAGTCCATCCC 0: 1
1: 0
2: 1
3: 13
4: 132
Right 950772440 3:15323249-15323271 AGTCCATCCCGCTGTAATCCTGG 0: 1
1: 0
2: 0
3: 2
4: 63
950772438_950772440 -1 Left 950772438 3:15323227-15323249 CCTGCTGATCCAGTGACTACAAA 0: 1
1: 1
2: 0
3: 9
4: 115
Right 950772440 3:15323249-15323271 AGTCCATCCCGCTGTAATCCTGG 0: 1
1: 0
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950772440 Original CRISPR AGTCCATCCCGCTGTAATCC TGG Intronic
901705833 1:11072405-11072427 ATTCAATCCCTCTGTAACCCTGG + Intronic
902518956 1:17005072-17005094 AGTCCATACCTCTGTGTTCCAGG - Exonic
912735212 1:112144310-112144332 ACTCAATCCCAGTGTAATCCTGG + Intergenic
913035020 1:114956273-114956295 AGTCCTTCCTGCTGCAATCAGGG + Intronic
914080844 1:144410328-144410350 GGTCCATTCCTCTGTCATCCAGG + Intergenic
917453461 1:175166280-175166302 AGTCCATCCTGCTGTCACCTGGG - Intronic
921698044 1:218234699-218234721 ACTCCATCCCGCTGAAGTTCTGG - Intergenic
1064189113 10:13189858-13189880 AGCCCCTGACGCTGTAATCCAGG + Intronic
1079161268 11:17996492-17996514 AGGCCATTCCGCTGAAATCATGG - Intronic
1087169179 11:95033059-95033081 AGTCCATCCTCCTGTATGCCTGG - Intergenic
1089376549 11:117999095-117999117 AGTCAATGCCACTGTCATCCTGG - Exonic
1092908720 12:13125908-13125930 AGTCAAGCCCTCTGTATTCCAGG - Intronic
1100559427 12:95733293-95733315 ACTCCAGCCTGCTGGAATCCCGG - Intronic
1104211169 12:126690156-126690178 AGTTCATCCAGGTGTGATCCTGG + Intergenic
1109269758 13:60241688-60241710 AGTCTCTACCGCTGGAATCCAGG - Intergenic
1118275886 14:64386168-64386190 AGTCTATCCCTCTGTAAAACGGG + Intergenic
1124458470 15:29866875-29866897 GGGCCATCCCGCTGTCTTCCTGG - Intronic
1133481290 16:6173190-6173212 TGTCCACGCCGCTGTAATCCTGG - Intronic
1146844788 17:36175753-36175775 GGTCCATCCAGCTGTTCTCCAGG - Intronic
1146857092 17:36263688-36263710 GGTCCATCCAGCTGTTCTCCAGG - Intronic
1146863523 17:36324687-36324709 GGTCCATCCAGCTGTTCTCCAGG + Intronic
1146873004 17:36387598-36387620 GGTCCATCCAGCTGTTCTCCAGG - Intronic
1146880362 17:36438684-36438706 GGTCCATCCAGCTGTTCTCCAGG - Intronic
1147066383 17:37925275-37925297 GGTCCATCCAGCTGTTCTCCAGG + Intronic
1147075887 17:37988223-37988245 GGTCCATCCAGCTGTTCTCCAGG - Intronic
1147077916 17:38004836-38004858 GGTCCATCCAGCTGTTCTCCAGG + Intronic
1147087412 17:38067769-38067791 GGTCCATCCAGCTGTTCTCCAGG - Intronic
1147093852 17:38128771-38128793 GGTCCATCCAGCTGTTCTCCAGG + Intergenic
1147103356 17:38191732-38191754 GGTCCATCCAGCTGTTCTCCAGG - Intergenic
1148395670 17:47306298-47306320 AGTCTCTCCCTCTGTCATCCAGG + Intronic
1150086284 17:62274818-62274840 AGTCCATCCAGGTGTTCTCCAGG - Intronic
1156599189 18:38584245-38584267 AATTAATCCTGCTGTAATCCTGG + Intergenic
1164415224 19:28041509-28041531 AGTCCATCTCTCTCTAATTCAGG - Intergenic
1164792677 19:31001600-31001622 AGTTTATCCCTCTGTAATGCAGG + Intergenic
1167329916 19:48848923-48848945 AGTCCCTCCCTCTGTCACCCAGG + Intronic
927695521 2:25237040-25237062 GGCCCTTCCCGCTGTTATCCAGG - Intronic
935863947 2:107364477-107364499 TGTTCATCCCCATGTAATCCAGG - Intergenic
1174248870 20:49203014-49203036 AGAGCATCCCTCTGTCATCCAGG - Intergenic
1184318092 22:43714443-43714465 TGTCCATCACACTGTATTCCAGG + Intronic
950772440 3:15323249-15323271 AGTCCATCCCGCTGTAATCCTGG + Intronic
968201053 3:196755801-196755823 AGATCATGCCGCTGTACTCCAGG - Intronic
968879285 4:3290954-3290976 AGTCCATCCCCGTGAAAGCCAGG - Intergenic
973333255 4:48931071-48931093 AGTCCATCTGGCTATATTCCAGG + Intergenic
983016224 4:162616379-162616401 AATCCATTCCTCTGTACTCCAGG + Intergenic
987108499 5:14663924-14663946 ATTCCATCCCGCCCTATTCCGGG + Intergenic
989578407 5:43010126-43010148 AGTCCAGCCCCCGGTGATCCCGG + Intergenic
993045781 5:82864723-82864745 AGTCCTTCTCTCAGTAATCCTGG - Intergenic
994848275 5:105019462-105019484 AGCCCATCCAGCTGTAAAACTGG + Intergenic
998007901 5:138669397-138669419 AGACCATCCCACTTTAATCTGGG - Intronic
1003055194 6:2812008-2812030 AATACATCCTGCTGTAATCTAGG - Intergenic
1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG + Exonic
1008049017 6:46881072-46881094 AGTGCAGCCCTCTGTCATCCCGG - Intronic
1012437711 6:99232473-99232495 AGCAGATCCCGCTGGAATCCCGG - Intergenic
1015275305 6:131377862-131377884 TGTCCCTACCGCTCTAATCCAGG + Intergenic
1026500057 7:70936432-70936454 AGTGCATCCCCCAGTAATCAAGG - Intergenic
1029064460 7:97835315-97835337 AGTACCTCCCTCTGTCATCCAGG - Intergenic
1036662719 8:10718180-10718202 AGTCCCTCCTGCTGCAGTCCAGG - Intergenic
1037435966 8:18863647-18863669 AGTCCATCCAGATTTATTCCAGG + Intronic
1046877856 8:119276277-119276299 AGTCCCTTCCTCTGTCATCCAGG + Intergenic
1054897676 9:70332250-70332272 AGTGCCTCACACTGTAATCCCGG + Intronic
1056592456 9:87974440-87974462 GGTCCATCCCGCTGCAGTCGTGG + Exonic
1060376237 9:123117245-123117267 TGTGCACCCTGCTGTAATCCTGG - Intronic
1185630068 X:1510262-1510284 AGTCCATCACGCTCTAAGCCAGG - Intronic
1191241055 X:58190378-58190400 AGTCCATCCCGTTAGAATGCTGG - Intergenic
1196179213 X:112671788-112671810 AGTCCATTCAGCTGGAAGCCGGG - Intronic
1197115941 X:122833887-122833909 ACTCCATCCCTCTGTGATCATGG - Intergenic