ID: 950775409

View in Genome Browser
Species Human (GRCh38)
Location 3:15345683-15345705
Sequence CACCCGGTGATTCACTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950775409_950775412 8 Left 950775409 3:15345683-15345705 CCAACCAAGTGAATCACCGGGTG No data
Right 950775412 3:15345714-15345736 TTCTAAGCAGAGAGAGCAGCTGG No data
950775409_950775413 17 Left 950775409 3:15345683-15345705 CCAACCAAGTGAATCACCGGGTG No data
Right 950775413 3:15345723-15345745 GAGAGAGCAGCTGGTGCTCATGG No data
950775409_950775415 19 Left 950775409 3:15345683-15345705 CCAACCAAGTGAATCACCGGGTG No data
Right 950775415 3:15345725-15345747 GAGAGCAGCTGGTGCTCATGGGG No data
950775409_950775414 18 Left 950775409 3:15345683-15345705 CCAACCAAGTGAATCACCGGGTG No data
Right 950775414 3:15345724-15345746 AGAGAGCAGCTGGTGCTCATGGG No data
950775409_950775416 20 Left 950775409 3:15345683-15345705 CCAACCAAGTGAATCACCGGGTG No data
Right 950775416 3:15345726-15345748 AGAGCAGCTGGTGCTCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950775409 Original CRISPR CACCCGGTGATTCACTTGGT TGG (reversed) Intergenic