ID: 950775410

View in Genome Browser
Species Human (GRCh38)
Location 3:15345687-15345709
Sequence TTTTCACCCGGTGATTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950775410_950775417 27 Left 950775410 3:15345687-15345709 CCAAGTGAATCACCGGGTGAAAA No data
Right 950775417 3:15345737-15345759 TGCTCATGGGGGAATGAGCTAGG No data
950775410_950775413 13 Left 950775410 3:15345687-15345709 CCAAGTGAATCACCGGGTGAAAA No data
Right 950775413 3:15345723-15345745 GAGAGAGCAGCTGGTGCTCATGG No data
950775410_950775415 15 Left 950775410 3:15345687-15345709 CCAAGTGAATCACCGGGTGAAAA No data
Right 950775415 3:15345725-15345747 GAGAGCAGCTGGTGCTCATGGGG No data
950775410_950775414 14 Left 950775410 3:15345687-15345709 CCAAGTGAATCACCGGGTGAAAA No data
Right 950775414 3:15345724-15345746 AGAGAGCAGCTGGTGCTCATGGG No data
950775410_950775412 4 Left 950775410 3:15345687-15345709 CCAAGTGAATCACCGGGTGAAAA No data
Right 950775412 3:15345714-15345736 TTCTAAGCAGAGAGAGCAGCTGG No data
950775410_950775416 16 Left 950775410 3:15345687-15345709 CCAAGTGAATCACCGGGTGAAAA No data
Right 950775416 3:15345726-15345748 AGAGCAGCTGGTGCTCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950775410 Original CRISPR TTTTCACCCGGTGATTCACT TGG (reversed) Intergenic