ID: 950775411

View in Genome Browser
Species Human (GRCh38)
Location 3:15345699-15345721
Sequence GCTTAGAACACATTTTCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950775411_950775414 2 Left 950775411 3:15345699-15345721 CCGGGTGAAAATGTGTTCTAAGC No data
Right 950775414 3:15345724-15345746 AGAGAGCAGCTGGTGCTCATGGG No data
950775411_950775415 3 Left 950775411 3:15345699-15345721 CCGGGTGAAAATGTGTTCTAAGC No data
Right 950775415 3:15345725-15345747 GAGAGCAGCTGGTGCTCATGGGG No data
950775411_950775418 19 Left 950775411 3:15345699-15345721 CCGGGTGAAAATGTGTTCTAAGC No data
Right 950775418 3:15345741-15345763 CATGGGGGAATGAGCTAGGTAGG No data
950775411_950775417 15 Left 950775411 3:15345699-15345721 CCGGGTGAAAATGTGTTCTAAGC No data
Right 950775417 3:15345737-15345759 TGCTCATGGGGGAATGAGCTAGG No data
950775411_950775412 -8 Left 950775411 3:15345699-15345721 CCGGGTGAAAATGTGTTCTAAGC No data
Right 950775412 3:15345714-15345736 TTCTAAGCAGAGAGAGCAGCTGG No data
950775411_950775419 26 Left 950775411 3:15345699-15345721 CCGGGTGAAAATGTGTTCTAAGC No data
Right 950775419 3:15345748-15345770 GAATGAGCTAGGTAGGTTTGAGG No data
950775411_950775416 4 Left 950775411 3:15345699-15345721 CCGGGTGAAAATGTGTTCTAAGC No data
Right 950775416 3:15345726-15345748 AGAGCAGCTGGTGCTCATGGGGG No data
950775411_950775413 1 Left 950775411 3:15345699-15345721 CCGGGTGAAAATGTGTTCTAAGC No data
Right 950775413 3:15345723-15345745 GAGAGAGCAGCTGGTGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950775411 Original CRISPR GCTTAGAACACATTTTCACC CGG (reversed) Intergenic