ID: 950775413

View in Genome Browser
Species Human (GRCh38)
Location 3:15345723-15345745
Sequence GAGAGAGCAGCTGGTGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950775410_950775413 13 Left 950775410 3:15345687-15345709 CCAAGTGAATCACCGGGTGAAAA No data
Right 950775413 3:15345723-15345745 GAGAGAGCAGCTGGTGCTCATGG No data
950775409_950775413 17 Left 950775409 3:15345683-15345705 CCAACCAAGTGAATCACCGGGTG No data
Right 950775413 3:15345723-15345745 GAGAGAGCAGCTGGTGCTCATGG No data
950775411_950775413 1 Left 950775411 3:15345699-15345721 CCGGGTGAAAATGTGTTCTAAGC No data
Right 950775413 3:15345723-15345745 GAGAGAGCAGCTGGTGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950775413 Original CRISPR GAGAGAGCAGCTGGTGCTCA TGG Intergenic