ID: 950780096

View in Genome Browser
Species Human (GRCh38)
Location 3:15384272-15384294
Sequence TTGGAAGCTCTGAGCACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950780096_950780101 27 Left 950780096 3:15384272-15384294 CCTCATGTGCTCAGAGCTTCCAA 0: 1
1: 0
2: 1
3: 10
4: 207
Right 950780101 3:15384322-15384344 AAATATGAATGGAAAACCAAGGG 0: 1
1: 0
2: 6
3: 95
4: 758
950780096_950780100 26 Left 950780096 3:15384272-15384294 CCTCATGTGCTCAGAGCTTCCAA 0: 1
1: 0
2: 1
3: 10
4: 207
Right 950780100 3:15384321-15384343 AAAATATGAATGGAAAACCAAGG 0: 1
1: 1
2: 7
3: 81
4: 667
950780096_950780099 16 Left 950780096 3:15384272-15384294 CCTCATGTGCTCAGAGCTTCCAA 0: 1
1: 0
2: 1
3: 10
4: 207
Right 950780099 3:15384311-15384333 GCATTAAAAAAAAATATGAATGG 0: 1
1: 0
2: 8
3: 161
4: 1535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950780096 Original CRISPR TTGGAAGCTCTGAGCACATG AGG (reversed) Intronic
901651739 1:10746964-10746986 TGGGTAGCTCTGAGATCATGTGG + Intronic
902784949 1:18726923-18726945 TTGGAAGCTCAGAGGATACGTGG - Intronic
903828977 1:26163711-26163733 TTGGGAGCTCAGAGCAGGTGAGG - Intergenic
906143985 1:43549342-43549364 TGGGAAGCTCTGGGCACCTCAGG + Intronic
908009406 1:59760320-59760342 TTGGAAGCTCTGTGCATAGTTGG + Intronic
911693729 1:100863829-100863851 TTGGGAGGTCTGAGCTCATTAGG + Intergenic
917443894 1:175090691-175090713 TTAGAAGCTCTGTTCACATCAGG - Intronic
921052515 1:211521140-211521162 TCTGAATCTGTGAGCACATGAGG + Intergenic
922161792 1:223083642-223083664 TTGGAAGTTTGGAGAACATGAGG + Intergenic
922331314 1:224579354-224579376 TTGGAAACTCTGAGCATGTTGGG + Intronic
922855691 1:228773371-228773393 TTGGAAGCCCTTTGCACATGAGG - Intergenic
924945428 1:248843189-248843211 TAGGAAGCCCAGATCACATGGGG + Intronic
1063598287 10:7457420-7457442 ATGGAAGCTCTGGGAACATCTGG - Intergenic
1064869396 10:19920629-19920651 GAGGTAGCTCTGAGCAGATGGGG - Intronic
1067261701 10:44698697-44698719 TTGGAAGATGTGGGAACATGGGG - Intergenic
1067693681 10:48520412-48520434 TCTGACGCTCTGAGCACCTGCGG - Intronic
1067717986 10:48704338-48704360 TTGGAAGCTCTGCTCTCCTGAGG - Intronic
1070614019 10:77955227-77955249 TTGAAAAGTCTGAGCACATGGGG + Intergenic
1070635069 10:78119060-78119082 TTGGGAGCTCTGAGGACATAGGG + Intergenic
1071380886 10:85058368-85058390 TTGGAGACACAGAGCACATGTGG + Intergenic
1072465003 10:95655522-95655544 TTGAAAGCTCTGAACACCTACGG + Intronic
1072698888 10:97625261-97625283 TTGTAGACTCTGAGCACAGGAGG + Intronic
1073138298 10:101231525-101231547 TTGGAAGCTCTGGGGCCAAGAGG + Intergenic
1074441723 10:113483180-113483202 TAGGATGCTGTGAGCAAATGGGG - Intergenic
1074575084 10:114661368-114661390 TGAAAAGCTCTGAGCACTTGGGG - Intronic
1075222616 10:120598356-120598378 GAGGATGCTCTGAGCACCTGGGG - Exonic
1076210637 10:128641694-128641716 TTGTAAGCACTGGGCACATCTGG + Intergenic
1076218293 10:128713109-128713131 ATGGAAGCCCTGAGCACACTGGG - Intergenic
1076395026 10:130132110-130132132 TTGCATGCTCTGAGCACTGGAGG - Intergenic
1077716616 11:4587605-4587627 TTGAAAGCATTAAGCACATGTGG + Exonic
1077717309 11:4594753-4594775 TTGAAAGCATTAAGCACATGTGG + Exonic
1077846141 11:6026959-6026981 GTGAAGGCCCTGAGCACATGTGG - Exonic
1077847963 11:6046014-6046036 GTGAAGGCCCTGAGCACATGTGG - Intergenic
1078368046 11:10722645-10722667 TTGGAAGCCCTAGGCACTTGAGG - Intergenic
1078457528 11:11486831-11486853 TTGGCTGCTTTTAGCACATGGGG - Intronic
1078531696 11:12141438-12141460 AAGCAAGCTCTGACCACATGAGG - Intronic
1081982950 11:47281144-47281166 TTGGGAGCCCTGAGCATTTGAGG + Intronic
1084476592 11:69392804-69392826 ACGGAAGCTCCGTGCACATGGGG + Intergenic
1085661907 11:78375892-78375914 TAGGATGGTCTGAGCACATCTGG - Intronic
1087126888 11:94637172-94637194 ATGGAGGCTCTAATCACATGTGG + Intergenic
1088386692 11:109266297-109266319 TTTGAAGCTGTTAGCACATTGGG + Intergenic
1089122622 11:116148012-116148034 GAGGCAGCTCTTAGCACATGGGG - Intergenic
1089557629 11:119323353-119323375 CTGGAAGCTCTGGGCACTCGCGG + Intergenic
1091728721 12:2864352-2864374 GGGCAAGCTCTGAGCTCATGAGG + Exonic
1092064424 12:5578167-5578189 CTGGAAGCTCAGATCACAAGTGG + Intronic
1092456293 12:8646108-8646130 TTGGAAACTCTGTGCCTATGAGG + Exonic
1102796845 12:115696273-115696295 TGGGAAGTTCTGAGCAGAGGAGG + Intergenic
1102984870 12:117269883-117269905 ATGGGTGCTCTGAGCTCATGAGG + Intronic
1103254658 12:119530814-119530836 CTGGAAGATCTGAGCACCTCTGG - Intronic
1103324120 12:120109063-120109085 GTGCATGGTCTGAGCACATGTGG - Intronic
1104296770 12:127522910-127522932 TTCCTAGCTCTGAGCCCATGAGG - Intergenic
1104326358 12:127802424-127802446 TTTAAAGCTGTGAGCAGATGGGG + Intergenic
1104771024 12:131364393-131364415 GTGGAAGCACTGAGATCATGAGG - Intergenic
1104905340 12:132210392-132210414 CTGGAAGCGCTGGGGACATGCGG + Intronic
1105279533 13:18955209-18955231 ATGGAGGCACTGAGCCCATGGGG - Intergenic
1105829367 13:24150270-24150292 TTGAGAGCACTGAGGACATGCGG - Intronic
1106010697 13:25818838-25818860 ATATAATCTCTGAGCACATGGGG + Intronic
1106850820 13:33789210-33789232 TTGGGATCTCTGAGCTGATGTGG + Intergenic
1107513809 13:41109798-41109820 GTGGAAACTGTGAGAACATGGGG - Intergenic
1108146901 13:47487121-47487143 TTGGAAGCACTTAACAGATGTGG + Intergenic
1108550205 13:51536303-51536325 GTTCCAGCTCTGAGCACATGGGG + Intergenic
1110073886 13:71214372-71214394 TTGGCAGTTCTGAGCAGAGGAGG + Intergenic
1110658433 13:78029032-78029054 TTATAAGCCCTGAGCATATGAGG + Intergenic
1111601024 13:90474319-90474341 GTGGAAGCTCTGAGCAACTTTGG + Intergenic
1114892088 14:26937359-26937381 TAGGAAGTCCTGAGAACATGTGG - Intergenic
1115914827 14:38300401-38300423 TAGGAAGCTCAGAGAACATCAGG + Intergenic
1121879821 14:97490020-97490042 CTGGAAGGTCTGTGCCCATGGGG + Intergenic
1123106829 14:105845708-105845730 CTGGAGGCTCTGAGGACAAGGGG + Intergenic
1125024180 15:35013819-35013841 TGGGAAGCTATTAGGACATGAGG + Intergenic
1128389576 15:67174034-67174056 TTGGAAACCATGAACACATGTGG + Intronic
1129722800 15:77887344-77887366 TTGGATTCTGTTAGCACATGTGG - Intergenic
1130678834 15:85978642-85978664 ATGGAAGTTCTGAGCAAAGGTGG - Intergenic
1132245402 15:100292616-100292638 TGGGCAGTTCTGTGCACATGGGG - Intronic
1134678575 16:16107955-16107977 TCGGAAGCTCTGGACACATCCGG - Intronic
1135036943 16:19086452-19086474 TTTCAAGCTCTGAACACATGAGG - Intergenic
1136632387 16:31496574-31496596 CTGGATGTTCTGATCACATGAGG - Intronic
1137562269 16:49510556-49510578 CTGGCAGCTCTGCCCACATGGGG - Intronic
1139198096 16:64944489-64944511 TTGGAGTCTCTGAGCAGAAGAGG - Exonic
1139715337 16:68808930-68808952 TCAGAGGCTCTGAACACATGAGG + Intronic
1141402918 16:83766540-83766562 TTGGAAGTTATGAGTACAAGTGG - Intronic
1144498875 17:15768609-15768631 TGGGAGGATCTGAGCACCTGTGG - Intergenic
1152797999 17:82317342-82317364 CTGGGGGCTCTGAGCTCATGGGG + Intronic
1152845444 17:82596955-82596977 GTGAGAGCTCTGAGCACAAGGGG - Intronic
1153380221 18:4430127-4430149 TAGGAAGCAGAGAGCACATGGGG + Intronic
1153885993 18:9467068-9467090 TTGGAAACTCTGTGCACTTCTGG - Intergenic
1155912208 18:31516929-31516951 TGGGTAGCCCTTAGCACATGTGG + Intronic
1157717571 18:49899284-49899306 TTGCAATCTCTTAGCAGATGGGG - Intronic
1160071499 18:75632830-75632852 TGTGAAGCACTGAGCACATTTGG + Intergenic
1161379620 19:3958213-3958235 GTGGAAGCTCTGGGCAGCTGAGG - Intergenic
1164788943 19:30959697-30959719 TTTGAAGCTCTGCCCTCATGGGG - Intergenic
1166360293 19:42250296-42250318 TGGGGACCCCTGAGCACATGTGG - Intronic
1168008409 19:53509720-53509742 GGGAAAGCTCTGATCACATGTGG + Intergenic
1168466990 19:56611056-56611078 TTGGAAGGTCTGAGCAGGAGAGG - Intronic
925455908 2:4016472-4016494 TGGGCAGCTCTGTTCACATGTGG - Intergenic
925900092 2:8503023-8503045 TAGGAAGTTCTCAGCACACGTGG + Intergenic
926409635 2:12589799-12589821 TTGGAACCTCTGAGCCCAGAAGG - Intergenic
928021860 2:27711816-27711838 TTGGAAACTCTGAACACACCGGG + Intronic
930402710 2:50910877-50910899 TTGGAAGCCCTTAGCACATTTGG - Intronic
932823745 2:74922309-74922331 CTGGAAGCTCTGAGAAGGTGGGG - Intergenic
936461628 2:112718538-112718560 TTGAAGGCTCTGTGCACCTGAGG - Intergenic
937977431 2:127590063-127590085 ATGGAAGCACAGAGCACAAGTGG - Intronic
940637559 2:156318011-156318033 TGGGAAGCTCTGGGCTAATGAGG - Intergenic
940908193 2:159187238-159187260 AGGGCTGCTCTGAGCACATGTGG + Intronic
942942147 2:181631313-181631335 TTGGAAGCTCTGAGAAGCTCTGG - Intronic
947395031 2:229677959-229677981 TTTGCAGCTCTCAGTACATGGGG + Intronic
947411704 2:229848177-229848199 TTATAAGCTCTGAGTACATAAGG - Intronic
1169349706 20:4858269-4858291 GAGGAAGCTCTGAGCACACAGGG + Intronic
1172460689 20:35116122-35116144 TTGGAAGCTGGGAGCCCATTTGG - Intronic
1173744767 20:45427741-45427763 TTAGGAGCCCTCAGCACATGCGG + Intergenic
1175724118 20:61305617-61305639 TGGGAAGCTCTGAGACCAAGGGG - Intronic
1175813011 20:61868835-61868857 CGGGGAGCTCTGAGCACACGTGG + Intronic
1178373881 21:32050495-32050517 ATGGAAGCTCCAGGCACATGAGG - Intergenic
1178701019 21:34834324-34834346 TGGGAAGGTGTGTGCACATGGGG + Intronic
1179342984 21:40530416-40530438 TTGGGAGCTCTGATAACAGGTGG + Intronic
1179445822 21:41429538-41429560 TGGGATGCCCTGGGCACATGAGG + Intronic
1179600199 21:42472272-42472294 TAGGAAGCACTTAGAACATGAGG - Intergenic
1185007839 22:48294409-48294431 CTGGCAGTTCTGGGCACATGTGG - Intergenic
1185200783 22:49503180-49503202 TTGTAAGATCTGTGCACATAAGG - Intronic
949337203 3:2988038-2988060 TTGGTAGCTCTAACCACATTAGG - Intronic
950032064 3:9859957-9859979 CTGGAGGCTCTGAGCACCTCTGG + Intergenic
950624139 3:14231882-14231904 TAGGAAGCTCTGGGGACATGGGG - Intergenic
950780096 3:15384272-15384294 TTGGAAGCTCTGAGCACATGAGG - Intronic
951587255 3:24228050-24228072 TTGAAATCTCTGGACACATGGGG + Intronic
951915097 3:27792205-27792227 TTGGAAGCTGAGAGACCATGTGG + Intergenic
952760513 3:36909348-36909370 CTGGCAGCCCTGACCACATGGGG + Intronic
953544807 3:43856638-43856660 TTGGGAGCTCTGAGCTCAGAGGG + Intergenic
955067070 3:55543010-55543032 ATGGAGGCTTTGAGCAGATGTGG - Intronic
956708065 3:72016372-72016394 TGGGGAGAGCTGAGCACATGGGG + Intergenic
957312804 3:78541780-78541802 TTGGATTCTCTCAGCACCTGGGG + Intergenic
958448623 3:94245842-94245864 TTGGAAGCTTTGTGCATATGTGG + Intergenic
959743286 3:109746592-109746614 TTGGCAGCTCTGGGCACAAATGG - Intergenic
959816570 3:110680914-110680936 TTGCAAGCTATGACCACAAGAGG - Intergenic
962722451 3:138188053-138188075 CTGGCAGCTCTGAGGAAATGGGG - Intronic
963056089 3:141187493-141187515 TGGGAAGGGCTGAGGACATGGGG - Intergenic
963861091 3:150311386-150311408 TTGGAGGCTCTGGAGACATGTGG - Intergenic
964716054 3:159723026-159723048 CTGGAAGCACTGAGCACACATGG - Intronic
965817241 3:172650041-172650063 ATGCATGCTCTGAGTACATGCGG + Intronic
965844686 3:172947424-172947446 ATGTATGCTCTGAGTACATGTGG + Intronic
966866771 3:184262503-184262525 GGGGAAGCTCGGAGCACCTGAGG + Intronic
966871604 3:184293499-184293521 TTGGGAGCTCTGAGCCTTTGAGG - Intronic
967249636 3:187523673-187523695 TTGGAAGCTCTGGATTCATGGGG + Intergenic
968969492 4:3786179-3786201 TTGGGAGCCCTGAGCACAGATGG + Intergenic
971125819 4:23752881-23752903 TTGAAGGACCTGAGCACATGGGG - Intergenic
971573990 4:28250956-28250978 TTGGCAGCATTGAGCCCATGTGG - Intergenic
973087676 4:46088036-46088058 TTGGAAGCACTGGCCACAAGTGG - Intronic
973218359 4:47697402-47697424 CTGGAAGCTCTGAGTACAAAAGG + Intronic
973931820 4:55800975-55800997 TTGGAAGCGCTGTGCAAATAAGG - Intergenic
976362064 4:84191868-84191890 TTAGAAGCTCTGAGACCCTGAGG + Intergenic
979444780 4:120798814-120798836 TTGGAAGCTCTGCCTCCATGAGG - Intronic
979796942 4:124857837-124857859 TTGGTAGCTCTCAGCAGGTGAGG - Intergenic
981831822 4:149010523-149010545 TTGGGATCTCAGAGCAAATGGGG + Intergenic
985623033 5:965776-965798 TTGGAATTTCTGAACACAGGAGG - Intergenic
985846614 5:2354231-2354253 TTGGAAGGTCTGAGCACCCAGGG - Intergenic
986443277 5:7799498-7799520 TTGGAAGCTCTGAGGCTCTGAGG - Intronic
986606423 5:9527791-9527813 TTGGTAGCTGTGAGGACCTGAGG - Intronic
986667177 5:10114108-10114130 CTGGCAGCTGTGAGCACAGGTGG - Intergenic
987673396 5:21044211-21044233 TGGGTAGCTCTCAGCAGATGGGG + Intergenic
991531655 5:67621908-67621930 TTTAAAGCTCTGAGCACAGTAGG + Intergenic
992169832 5:74090598-74090620 TGGGAAACGCTGAGGACATGGGG - Intergenic
994775412 5:104032213-104032235 CTGGTTGCTCTGAGGACATGAGG - Intergenic
996839345 5:127829220-127829242 TTGGAATATCTAAGTACATGTGG + Intergenic
997280724 5:132643069-132643091 TGGAAAGCTCTGACCACTTGAGG + Exonic
997381884 5:133444292-133444314 TTAGAAGCACTGAGCACAGTTGG + Intronic
997480951 5:134184223-134184245 ATGGCAACTCTGAGCACATGGGG - Intronic
998790854 5:145765185-145765207 TGAGTAGTTCTGAGCACATGCGG - Intronic
999370720 5:151053528-151053550 TTGGAAGCTCTGTGAACTGGGGG + Intronic
1000829266 5:166083254-166083276 TTGGAACCTCTGAGAACTTTGGG + Intergenic
1001940606 5:175737023-175737045 TTGGAAGCTCTGAAGAGCTGGGG - Intergenic
1003498039 6:6681623-6681645 CTGGAAGCTAGGAGTACATGTGG + Intergenic
1005168959 6:22959017-22959039 ATGGCAGAGCTGAGCACATGGGG - Intergenic
1005360962 6:25030361-25030383 GGGGAAGCTCTGAGCAAACGAGG - Intronic
1005975556 6:30795795-30795817 GTGGAAGGTCTGAGTTCATGGGG - Intergenic
1006984259 6:38166898-38166920 TGGAAAGTTCTGAGCACAGGAGG - Intergenic
1007422425 6:41727830-41727852 TTGGAAGCTCTGGGGCCAAGGGG - Intronic
1008463531 6:51804183-51804205 TTGGTAGTTATGAGCAAATGAGG - Intronic
1011726252 6:90213246-90213268 TCAGAAGCTCTTGGCACATGGGG - Intronic
1013648759 6:112172118-112172140 TTGCAAGCTATGATCACATCTGG + Intronic
1014779786 6:125550957-125550979 TTGGAAGCTTAGATCACATCTGG + Intergenic
1016016062 6:139187477-139187499 TAGGATGCTTTGAGCAGATGAGG - Intergenic
1016305321 6:142678036-142678058 TTGGAACCTGTTAGCACATAAGG - Intergenic
1016538535 6:145136744-145136766 TTTGAATCTCTGAACACATCAGG + Intergenic
1018344845 6:162890001-162890023 TAGAAAGGTCTGAGCACATCTGG + Intronic
1018893550 6:167998496-167998518 TGGCAAGTTCTGAGCACATACGG + Intronic
1019784089 7:2962820-2962842 CTGGAAGCTCGGAGAAAATGAGG + Intronic
1019860294 7:3652439-3652461 GTGGAAGCTGTGAGGCCATGAGG - Intronic
1020741330 7:12022666-12022688 GTGGAAGCTTTGAGTACAAGTGG + Intergenic
1022126118 7:27359304-27359326 TGGGAAGATCTAAGCAAATGGGG + Intergenic
1022233772 7:28441237-28441259 TTGAAAGCTCCAAGCCCATGAGG + Intronic
1023307795 7:38849476-38849498 GTGGTAGCTCTCAGCAGATGGGG + Intronic
1023609082 7:41956237-41956259 CTGGAATTTCTGAGCACAGGAGG + Intergenic
1031628377 7:124016995-124017017 TTGGAAGCTGTGTGCAAATCAGG - Intergenic
1032525890 7:132577776-132577798 GTGTCAGCTCTGAGCACCTGAGG - Intronic
1032744777 7:134774633-134774655 TGGGAACCTCTGAGGACAGGCGG - Intronic
1034000215 7:147403360-147403382 CAGGAAGATCTGAGGACATGTGG - Intronic
1035796559 8:2362664-2362686 TTGGAAGCTTTGAGCAGAGGGGG - Intergenic
1039432696 8:37537671-37537693 TTGGAAACTCTCAGCAAGTGAGG + Intergenic
1041242147 8:55857199-55857221 TTGAAAGTTCTGAGCCCTTGGGG + Intergenic
1041736123 8:61112912-61112934 TGGGAAGCTCTGAACACATGTGG + Intronic
1042615849 8:70648187-70648209 TTGGGAGCTCTGAGAATGTGGGG - Intronic
1045184571 8:99824220-99824242 CTGGAGCCTCTGAGCAGATGGGG - Intronic
1047736085 8:127766320-127766342 TTTTAAGCTCTGAGGACATTAGG + Intergenic
1048298021 8:133229259-133229281 TTGGAAGCTCTAAAAACAGGGGG - Exonic
1048654972 8:136525773-136525795 TTGGAAGCTCTGAGCTCCTTTGG - Intergenic
1051465460 9:17371815-17371837 TTGGAAGCTCTGCAGACATATGG + Intronic
1057407701 9:94788609-94788631 TTGGAAGCTGTGAATACATTTGG + Intronic
1059486593 9:114632006-114632028 TAGGAAGATCTGAGCTCAGGAGG + Intronic
1059550240 9:115221910-115221932 TTGGAAGATCTGGCAACATGAGG + Intronic
1060785529 9:126449201-126449223 GTGGGAGCTCAGAGCACACGGGG + Intronic
1062087479 9:134656239-134656261 TGGGAAACTCTGAGCAGAGGAGG + Intronic
1186344548 X:8678361-8678383 TTGGAATCTCTAGGCACTTGGGG - Intronic
1187065292 X:15829485-15829507 TTGCAGGCAGTGAGCACATGGGG - Intronic
1188526321 X:31091761-31091783 TCTGAATCTCTGACCACATGGGG + Intergenic
1190251745 X:48732099-48732121 TTGAAAGCTCTGAGCTCTTTCGG - Intergenic
1190791666 X:53706340-53706362 CTGGAAACTCTGAGTATATGTGG - Intergenic
1196387808 X:115177273-115177295 CTGGAAGCTCTGTGTGCATGGGG + Intronic
1197786220 X:130199844-130199866 TTTTTAGCTCTGAGAACATGTGG + Intergenic
1198782212 X:140249708-140249730 GTGGAAATTTTGAGCACATGTGG + Intergenic
1199947901 X:152682279-152682301 CTGGAAGCCCTGAGCAGGTGTGG + Intergenic
1199961778 X:152786175-152786197 CTGGAAGCCCTGAGCAGGTGTGG - Intergenic