ID: 950783904

View in Genome Browser
Species Human (GRCh38)
Location 3:15416617-15416639
Sequence CTCATCAAGGGGAATTAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950783904_950783911 0 Left 950783904 3:15416617-15416639 CCCTTCTAATTCCCCTTGATGAG 0: 1
1: 0
2: 1
3: 15
4: 115
Right 950783911 3:15416640-15416662 ATGCTCCCGCAGTTCTTCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 104
950783904_950783910 -1 Left 950783904 3:15416617-15416639 CCCTTCTAATTCCCCTTGATGAG 0: 1
1: 0
2: 1
3: 15
4: 115
Right 950783910 3:15416639-15416661 GATGCTCCCGCAGTTCTTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 100
950783904_950783909 -2 Left 950783904 3:15416617-15416639 CCCTTCTAATTCCCCTTGATGAG 0: 1
1: 0
2: 1
3: 15
4: 115
Right 950783909 3:15416638-15416660 AGATGCTCCCGCAGTTCTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950783904 Original CRISPR CTCATCAAGGGGAATTAGAA GGG (reversed) Intronic
901223442 1:7597051-7597073 GTCAGCAAGGGGCAATAGAAAGG - Intronic
902679098 1:18030551-18030573 CTCACCAAGGGAACTGAGAAAGG + Intergenic
903189475 1:21648813-21648835 AGCATCAAAGGGAAATAGAAAGG + Intronic
903994073 1:27294302-27294324 CTCATCAAGGTTAAGTAAAATGG + Intronic
907214899 1:52854372-52854394 CTCATCAAGTGGAATAGGTATGG + Intronic
907336988 1:53706260-53706282 ATCTTGAAGGGGAATCAGAATGG - Intronic
918874048 1:190015285-190015307 TTCATAAAGTGGAATCAGAATGG - Intergenic
1065682229 10:28248521-28248543 ATCATTAAGTGGAATTAGGAAGG - Intronic
1068157901 10:53224265-53224287 CCCAACTAGGGGAGTTAGAAAGG - Intergenic
1068746998 10:60543993-60544015 CTCCTCAAGGGGAAAGACAATGG + Intronic
1072344370 10:94488909-94488931 CTCCTCAAGTGGAAGAAGAAAGG + Intronic
1073052704 10:100679061-100679083 CCAATCAATGGGAATGAGAATGG - Intergenic
1073499763 10:103925768-103925790 GTCAGCAAGGGGAATGAGAGAGG + Intergenic
1075278921 10:121122153-121122175 CTCATCAAGAGGAAAGAGACAGG + Intergenic
1075632660 10:124010632-124010654 CCCACCAAGGGCAATTGGAAGGG - Intronic
1078762313 11:14261119-14261141 CTGGTCATGGGGAATTAAAATGG - Intronic
1081360036 11:42165493-42165515 CTAATTAAGGGGAAAAAGAATGG + Intergenic
1085537295 11:77229918-77229940 AGCATCAAGTGGAATTAGAGAGG - Intronic
1092968819 12:13671988-13672010 CTCATCATGGGTCATTAGGAGGG + Intronic
1095271955 12:40229100-40229122 CTTAACAAGGGGATGTAGAAAGG + Intronic
1096039014 12:48498045-48498067 CTAATCAAGAAGGATTAGAAGGG + Intergenic
1098000053 12:65931502-65931524 CTTATCAAGGGCAACAAGAATGG + Intronic
1098692646 12:73507626-73507648 CTCATCAAGGCCACATAGAAAGG + Intergenic
1099953359 12:89328341-89328363 CTCAGTACGAGGAATTAGAAGGG + Intergenic
1107767235 13:43749596-43749618 CTCCTCACGGGCAATTAGCAAGG + Intronic
1108304425 13:49117014-49117036 TTCATCAAGGGAGAATAGAAGGG + Intronic
1108377407 13:49826347-49826369 CTCATGAAGGGGAATTTGTGAGG + Intergenic
1111554430 13:89861965-89861987 CTCCTCAGGGGGAACTATAATGG - Intergenic
1113407848 13:110057794-110057816 CTCATCAAGGACAATTTTAAGGG - Intergenic
1121016766 14:90553638-90553660 CCCATCAAGTGGAAAGAGAACGG - Intronic
1121806058 14:96824485-96824507 CTCAGCAAGGGTTATTAGAGAGG + Intronic
1122450736 14:101804913-101804935 CTCATCATGGAGAATGGGAATGG - Intronic
1126692608 15:51299371-51299393 CTGGCCAAGGGGGATTAGAATGG - Intronic
1126915683 15:53463756-53463778 CTCAGGAAGGTGAATTGGAAGGG - Intergenic
1127292739 15:57584939-57584961 CTCATCAAGGATGACTAGAAAGG - Intergenic
1127370180 15:58331917-58331939 CACATCACAGGGAATTAGGAGGG - Intronic
1131734005 15:95312887-95312909 TTAATCAAGAGGAAATAGAAGGG + Intergenic
1132774886 16:1587899-1587921 CTCATCAAGGGGCACTGGAAAGG + Intronic
1138803072 16:60058566-60058588 CCAATCATGGGGAATGAGAAGGG + Intergenic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1148674904 17:49439440-49439462 CCCATCAAGAGAAACTAGAAGGG - Intronic
1150988509 17:70227559-70227581 CTCAGCAAGGAGAATGAGAAGGG + Intergenic
1155184848 18:23378562-23378584 CTCATCAAAAGGAATTATAAGGG - Intronic
1156602940 18:38631398-38631420 CTCATCCAGAGGAACTAGTAGGG + Intergenic
1156869008 18:41922694-41922716 CTTATCAAGGGGTGTGAGAAAGG + Intergenic
1157140339 18:45099607-45099629 CTAAGCAAGGAGAATTAGATTGG - Intergenic
1158102307 18:53842934-53842956 CACATCAAGGCTAATTAGAGGGG - Intergenic
1158314214 18:56192810-56192832 TTCATAAAGAGAAATTAGAATGG - Intergenic
1160167482 18:76527231-76527253 CTCATCAGGGTGAACTGGAAGGG + Intergenic
1161500784 19:4614204-4614226 ATCATGAGGGGGAATAAGAAAGG - Intergenic
1164382512 19:27746910-27746932 CTAATCAAGCGGCATTAGAAGGG + Intergenic
1166590406 19:43992745-43992767 CACAGCAAGGGGGATTAAAACGG - Intronic
929303786 2:40336162-40336184 CACATAAAGTGGAATTAGGATGG - Intronic
930159270 2:48137713-48137735 CCCAAAAAGGGAAATTAGAAAGG + Intergenic
930399983 2:50872098-50872120 CACATAAAGGGGAAAAAGAATGG - Intronic
932177862 2:69619196-69619218 GTCATCGAGGGGAATGAGAGAGG - Intronic
933115857 2:78470351-78470373 CTCATAAAGTGGAATTTCAATGG - Intergenic
934923779 2:98367127-98367149 CTCACCAAGGAGAATGAAAATGG - Intronic
936671881 2:114665615-114665637 CTCATTTAGGGGAATTAGTTTGG + Intronic
941108608 2:161392382-161392404 CTCACCAAGGTGTCTTAGAAGGG + Intronic
943381018 2:187148127-187148149 CTCACCAAGGTAAATTACAAAGG - Intergenic
943766167 2:191664846-191664868 ATCATCAAGGGGGATCAGGAAGG - Intergenic
945328484 2:208511669-208511691 ATAATCAAGGGGAAATAGATTGG + Intronic
946467382 2:219924187-219924209 CTCACCAAGGGGATGTGGAAAGG + Intergenic
1169582837 20:7044355-7044377 GTCATCAAGTTGAATGAGAAAGG + Intergenic
1172170772 20:32930584-32930606 CTCATCACGGGGGATTGTAAAGG + Intronic
1172569079 20:35954775-35954797 CTCATCAGGGTCAATCAGAAGGG - Exonic
1177723918 21:24943137-24943159 CACATCTAGGGAAATTAAAATGG - Intergenic
1184459810 22:44630806-44630828 CTCATCCAGGAGAGCTAGAAGGG - Intergenic
950545897 3:13637725-13637747 ATCATCAAGGGCAATGAGGAGGG + Exonic
950783904 3:15416617-15416639 CTCATCAAGGGGAATTAGAAGGG - Intronic
951353959 3:21641446-21641468 CTCATCACTGGGAATTTCAAAGG + Intronic
953927734 3:46990887-46990909 GTCATCATGGGGAAGTGGAAGGG + Intronic
955662674 3:61317816-61317838 CTCCTCAAGGGGAAAGAAAATGG - Intergenic
955832662 3:63020983-63021005 CTGATGGAGGGGAATCAGAAGGG - Intergenic
956392396 3:68787393-68787415 CTCATAAAGGGGAAAGAGAGGGG + Intronic
956939543 3:74141449-74141471 GACATCAAGAGGAATTTGAAAGG - Intergenic
958173531 3:89966480-89966502 CCCATTAAAGGGAATTAGATGGG + Intergenic
959200827 3:103244594-103244616 CTCATCTAGGGAAATCAGAAAGG - Intergenic
960405431 3:117253653-117253675 CACATCAAGGGAAAACAGAAAGG + Intergenic
965258827 3:166453025-166453047 CTCATAAAGGGCAATGATAATGG - Intergenic
967340741 3:188394704-188394726 CTCATCAAGGGAAACTTAAAAGG + Intronic
970466873 4:16332992-16333014 ATCATCCAGGAGAATGAGAAAGG - Intergenic
976705201 4:88012761-88012783 CACAGAAAGGGGAAGTAGAATGG - Intronic
978706437 4:111718265-111718287 CTCATTATGGGGAATGAGAATGG - Intergenic
979207205 4:118052987-118053009 CTCAAAAAGCGGAAATAGAATGG + Intronic
980251297 4:130319054-130319076 GTCAGCAAGGGGAGTGAGAAGGG + Intergenic
981401655 4:144321005-144321027 CTCATCAAGGGGAAACACATGGG + Intergenic
983650667 4:170033141-170033163 CTTATCATGGGGAATAAAAAAGG - Intergenic
983701756 4:170605149-170605171 CACATCATGGGAAAATAGAAGGG + Intergenic
983977436 4:173952618-173952640 CTCACCAAGGGGATCTAGACGGG + Intergenic
988430887 5:31117297-31117319 CTCATCAAGGGGAATTCAAAGGG + Intergenic
988728113 5:33943581-33943603 CTCATCATGGGGCAGTTGAAGGG + Intergenic
989048006 5:37291909-37291931 CTCTTCAAGCTAAATTAGAACGG - Exonic
989380487 5:40805274-40805296 TTCATAAAGTGGAATTAGAAAGG + Intergenic
993655914 5:90577801-90577823 CTCTTCAAGGAGAACTACAAAGG - Intronic
994456740 5:100018836-100018858 ATAACCAAGGGGAATTGGAAAGG - Intergenic
994616467 5:102110571-102110593 CTCATGAAGGGGAATGAAAACGG + Intergenic
994739981 5:103605964-103605986 CTGAACAATGGGAATTACAATGG - Intergenic
995269086 5:110200675-110200697 CTCATAAAGGCCATTTAGAAAGG - Intergenic
995385978 5:111589368-111589390 GTAATGAAGGGAAATTAGAAAGG - Intergenic
998796886 5:145829889-145829911 CTCATAAAGGGGATTTATGAAGG - Intronic
1001732279 5:173969270-173969292 GTCAAGAAGGGGAAATAGAAGGG - Intergenic
1003377636 6:5594223-5594245 CTCATCGAGGGGAACTTCAAAGG - Intronic
1005605112 6:27469193-27469215 CTCTTCAAGAGGATTTTGAAAGG - Intronic
1006415712 6:33902739-33902761 ATCACCAAGAGGAATTAGAATGG + Intergenic
1007199349 6:40092860-40092882 CTCATAAAATGAAATTAGAAAGG + Intergenic
1008088378 6:47267941-47267963 CTCATCATGGGGTCCTAGAAAGG + Intronic
1010283268 6:74045066-74045088 TTTATCAAGGCTAATTAGAAAGG - Intergenic
1029529942 7:101118643-101118665 GTCACCAAGGGGAATTTCAATGG - Intergenic
1031006466 7:116478578-116478600 GTCATCAAAGAGAATTATAAGGG - Intronic
1036289652 8:7476249-7476271 TTTATCAACAGGAATTAGAAAGG + Intergenic
1036331824 8:7835283-7835305 TTTATCAACAGGAATTAGAAAGG - Intergenic
1036678635 8:10854419-10854441 CTCATCAAAGGCAATTAGAGAGG - Intergenic
1038101876 8:24387205-24387227 TTAGTCAAGTGGAATTAGAAGGG - Intronic
1038794340 8:30696574-30696596 CTGATCAAGGGGTATAATAAGGG - Intronic
1040918815 8:52593223-52593245 CTCATCAAGAGGACTTACAATGG + Intergenic
1043143127 8:76616289-76616311 CAGATCAACGGGAAGTAGAAAGG + Intergenic
1043383063 8:79723354-79723376 CTGAGTAAGGGGAAATAGAAAGG + Intergenic
1055302635 9:74898286-74898308 CTCAGCAAGGGGAAAAAGAAGGG - Intergenic
1055343463 9:75309451-75309473 CTCATGAAGAGGAATGAAAATGG - Intergenic
1055842357 9:80519993-80520015 CTCACAGAGGGGAATGAGAAGGG - Intergenic
1058471481 9:105283733-105283755 CTCATAAGGTGGAATGAGAAAGG - Intronic
1186140085 X:6562538-6562560 CTCTTCCAGAGGAATGAGAAAGG - Intergenic
1187920111 X:24193471-24193493 TTCTTTATGGGGAATTAGAAGGG + Intronic
1188048154 X:25451690-25451712 CTCCTGAAAGGGAATAAGAATGG + Intergenic
1190390852 X:49930149-49930171 CAAATAAAGGGGAATTAGAATGG + Intronic
1192000040 X:67140136-67140158 ACCATCAAGGGGAATGAGGAGGG + Intergenic
1194559990 X:95408263-95408285 CTCATCCAGGGAAATTAGATTGG - Intergenic
1194656006 X:96574301-96574323 ATCATCAAGGGTAATTAGATAGG - Intergenic
1195766379 X:108300175-108300197 CTCCTTAAGTGGAATTAGTAGGG + Intronic
1198929705 X:141840857-141840879 CTATTCAAGGGGATTGAGAATGG + Intronic