ID: 950785828

View in Genome Browser
Species Human (GRCh38)
Location 3:15434670-15434692
Sequence CTCACTGTTCAGAGATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950785824_950785828 0 Left 950785824 3:15434647-15434669 CCATCAAAAAAATGTCTGCAGAG 0: 1
1: 0
2: 1
3: 30
4: 348
Right 950785828 3:15434670-15434692 CTCACTGTTCAGAGATGGGGAGG 0: 1
1: 0
2: 3
3: 13
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950785828 Original CRISPR CTCACTGTTCAGAGATGGGG AGG Intronic
900229930 1:1551575-1551597 CCCACTGGTCAGGGAGGGGGAGG + Intronic
900493555 1:2965546-2965568 CTGTCTGTTCAGAGATATGGTGG + Intergenic
904487742 1:30838725-30838747 GGCATTGTTCAGAGCTGGGGTGG - Intergenic
905649228 1:39645513-39645535 CTGAGTGTCCAGTGATGGGGAGG + Intergenic
905954508 1:41981141-41981163 CTCACTGTTCTCACAAGGGGAGG - Intronic
907790569 1:57659571-57659593 CACACTGGTCAGGGAAGGGGAGG - Intronic
908512007 1:64857147-64857169 TTCATTGTTCTAAGATGGGGTGG + Intronic
909108123 1:71438846-71438868 CTCACTGGCCAGTGATGGCGTGG + Intronic
909215301 1:72879029-72879051 CTCACAGCTCTGAGATGGTGTGG + Intergenic
910214778 1:84832231-84832253 ATCAGTGTTCCTAGATGGGGAGG - Intronic
910882027 1:91930316-91930338 CAGACTATTCTGAGATGGGGAGG + Intergenic
913243728 1:116852861-116852883 CTCAATGGGCAAAGATGGGGTGG + Intergenic
915210499 1:154305237-154305259 CCCATTGTTCAGAGCTGGGGTGG + Intergenic
917464614 1:175264863-175264885 CTAACAGTTTAGAGATGGGCAGG + Intergenic
918716962 1:187801810-187801832 ATCACTGTTCAAAGATACGGGGG + Intergenic
919774063 1:201182470-201182492 ATCGCTGTTCAGAAATTGGGAGG + Intergenic
920329000 1:205191354-205191376 CACACTGCTCAGTGATGTGGTGG + Intronic
921470852 1:215547548-215547570 GGCACTGTTCAGAGATGTGTGGG + Intergenic
921697185 1:218225184-218225206 CTCACTGTGCAGACCTGGGTTGG + Intergenic
922756193 1:228098272-228098294 CTCACTGTTCAGTGCTGAGAGGG + Exonic
923854466 1:237830683-237830705 CTCTCTATTCTGAGATGGGCAGG - Intronic
924855272 1:247869297-247869319 CTCCCTCTTCAGAGGTGGGGGGG + Intronic
1070015143 10:72520367-72520389 CTGCAAGTTCAGAGATGGGGTGG - Intronic
1071489322 10:86125271-86125293 CTCTCTGTGCTGAGGTGGGGAGG - Intronic
1071505899 10:86231324-86231346 CTGAGTGTGCAGAGATGGTGGGG - Intronic
1073057573 10:100712197-100712219 CTCACTCTGGAGAGGTGGGGTGG - Intergenic
1075580578 10:123614952-123614974 CCCACAGTTCAGAGCAGGGGTGG + Intergenic
1075973587 10:126675285-126675307 TTCACTGTTCAGCAATGGGACGG + Intergenic
1076133744 10:128030703-128030725 CTCAGTGTTCAGAGATGTCCAGG - Intronic
1076812832 10:132898207-132898229 CTCCCTGCTGGGAGATGGGGAGG - Intronic
1078667493 11:13338878-13338900 GTCAGTGTTCAGAGTTGTGGGGG + Intronic
1080639582 11:34150933-34150955 CTCAGAGTTCAGAACTGGGGAGG - Intergenic
1080840551 11:35979757-35979779 CTCCGTGTTGAGAGATGTGGTGG + Intronic
1083168110 11:60904165-60904187 ATCATTGTTCAGATATGAGGTGG - Intronic
1085304246 11:75476233-75476255 CTCCCATTTCAGAGATGGAGAGG + Intronic
1085704734 11:78776545-78776567 TTTACTGTTCAAAGATGGGCCGG - Intronic
1086534180 11:87824091-87824113 CTGTCTGCACAGAGATGGGGAGG - Intergenic
1086576658 11:88346496-88346518 CTCACTGATCAGATACGGGGTGG - Intergenic
1086644061 11:89197091-89197113 CTCACTGAGCAGAGAAGAGGAGG + Intronic
1088945015 11:114503179-114503201 CTCACTGTGCAGTGATAAGGTGG - Intergenic
1092144286 12:6203831-6203853 CTTTCTGGTCAGAGAAGGGGAGG + Intronic
1092317234 12:7430820-7430842 CTCAATGTTCTGAGGTGGGTTGG + Intronic
1093998912 12:25673717-25673739 CTCCCTTTGGAGAGATGGGGAGG + Intergenic
1094498069 12:31001707-31001729 CTCACTGTTGTGTGATGTGGTGG - Intergenic
1096498849 12:52053687-52053709 CTCAGTGTGCAGGGTTGGGGTGG + Intronic
1096932642 12:55230739-55230761 GTCACAGTTTAGAGATGGTGTGG + Intergenic
1097627751 12:62021617-62021639 CCTTCTGTTCTGAGATGGGGTGG + Intronic
1097832317 12:64238668-64238690 TTCCCTATTAAGAGATGGGGGGG - Intergenic
1103247182 12:119467696-119467718 GCCACTTTACAGAGATGGGGTGG - Intronic
1103269920 12:119664771-119664793 CTGGCTGTTCTTAGATGGGGAGG + Intergenic
1103444127 12:120982938-120982960 TTCAGACTTCAGAGATGGGGAGG - Intronic
1104082774 12:125445618-125445640 CTCAGGGTTCACAGCTGGGGTGG - Intronic
1104367132 12:128187905-128187927 CTCACTTTTCAGAGACCGGAAGG + Intergenic
1104824678 12:131700705-131700727 CACAATGCTCAAAGATGGGGAGG - Intergenic
1108333637 13:49416148-49416170 CTCACTGTTCATGGATGGGGAGG + Intronic
1108474118 13:50796763-50796785 CTCACTGTTCAGTCAGAGGGTGG - Intronic
1109500786 13:63234546-63234568 CTGACTCTTCAGAGTTGGGAGGG + Intergenic
1111566961 13:90028778-90028800 CTCACAGTTCATGGCTGGGGAGG - Intergenic
1118453716 14:65926893-65926915 TCCCCTGTACAGAGATGGGGGGG - Intergenic
1119982636 14:79099300-79099322 CTCACTGCACAGAGAGGGAGAGG + Intronic
1120898025 14:89551671-89551693 CACACTGTGCAGAGATAGAGTGG - Intronic
1121011618 14:90523266-90523288 CTCACTGATCAGAGAAGGGCGGG + Intergenic
1124129765 15:26973006-26973028 ATCTCTGTTTAGAGATGGAGAGG + Intronic
1127569798 15:60230849-60230871 ATCACTCTTCAGAGAGGGCGTGG + Intergenic
1129296066 15:74600804-74600826 CGCTCTGTCCAGGGATGGGGAGG + Intronic
1130000614 15:80043428-80043450 CTCAGGGTACAGAGTTGGGGAGG + Intergenic
1130541594 15:84824171-84824193 CACAGTCTTCAGGGATGGGGAGG - Intronic
1130559170 15:84945179-84945201 CTCACTGTGCACAGATCGTGTGG - Exonic
1132157266 15:99504394-99504416 TTCACTGTGGGGAGATGGGGGGG + Intergenic
1134515920 16:14886841-14886863 CCCACTGCTCAGAGACGGCGAGG + Exonic
1134703592 16:16285485-16285507 CCCACTGCTCAGAGATGGCGAGG + Exonic
1134963951 16:18426629-18426651 CCCACTGCTCAGAGATGGCGAGG - Exonic
1134968238 16:18509165-18509187 CCCACTGCTCAGAGATGGCGAGG - Intronic
1137773424 16:51036593-51036615 CTCATTGTTCAGAGGCGAGGTGG - Intergenic
1138008931 16:53360348-53360370 CTGACTGTGGAGAGAGGGGGTGG - Intergenic
1138086060 16:54134840-54134862 ATCACTGACCAGAGCTGGGGAGG - Intergenic
1138555982 16:57771479-57771501 CTCACTGTGAGGAGCTGGGGTGG + Intronic
1139340183 16:66263371-66263393 CTCAGCCTCCAGAGATGGGGGGG + Intergenic
1139851117 16:69952026-69952048 CTTCCTGTTCAGGGCTGGGGTGG - Exonic
1139880095 16:70174938-70174960 CTTCCTGTTCAGGGCTGGGGTGG - Exonic
1140372414 16:74420579-74420601 CTTCCTGTTCAGGGCTGGGGTGG + Exonic
1142787882 17:2238510-2238532 CTTTCTGGTCAGAGGTGGGGAGG + Intronic
1143923728 17:10351257-10351279 CTCACTGTACATAGATTTGGGGG + Intronic
1144573577 17:16415685-16415707 CTTAGTGCTCAGAGCTGGGGAGG + Exonic
1147387822 17:40092171-40092193 CTCCCTGCTCAGACTTGGGGAGG + Intronic
1148674157 17:49435305-49435327 CTCCCTGTCCCTAGATGGGGTGG - Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150127177 17:62644948-62644970 CCCAGTGTTCACAGAAGGGGAGG + Intronic
1150534477 17:66021552-66021574 CTCACTCTTCAGACCTGAGGGGG - Intronic
1151207481 17:72518758-72518780 CTCATTGTTTAGAGAGAGGGTGG + Intergenic
1151604390 17:75127201-75127223 GTCAGTTTTCTGAGATGGGGTGG - Intronic
1156962091 18:43044548-43044570 ATCACAGTTCAAAGATGGGAAGG + Intronic
1158957311 18:62552190-62552212 CTCAGAGTTCTGAGCTGGGGAGG + Intronic
1160174821 18:76584498-76584520 CTCACTTTTCATAGGTGGAGAGG - Intergenic
1160261952 18:77302336-77302358 TTCACTTTTTAGAGATGGAGCGG + Intergenic
1160929611 19:1564122-1564144 CTCCCAGGTCACAGATGGGGAGG - Intronic
1161773573 19:6244445-6244467 CCCACTGTTGAGAGAGGCGGGGG - Intronic
1161816103 19:6501182-6501204 CCCACAGACCAGAGATGGGGTGG - Intronic
1163117442 19:15197083-15197105 CTAAATGTTGAGAGATGGGAGGG + Intronic
1163815153 19:19460647-19460669 CTGGCTTTTCTGAGATGGGGAGG - Intronic
1166706557 19:44911206-44911228 CTCAGTTCTCAGAGACGGGGAGG + Intergenic
1167300386 19:48674288-48674310 CTCAGTGTCCAGAGAGGGAGGGG + Intergenic
926350940 2:11993990-11994012 CTGAAGGATCAGAGATGGGGCGG + Intergenic
927485290 2:23484653-23484675 CACACTGTTCTGAGATGGAGAGG - Intronic
928102406 2:28446942-28446964 CTCACAGTTCAGGGATGTAGGGG - Intergenic
929461439 2:42104689-42104711 CTCTCTGATCAGAGATGGAAAGG + Intergenic
930387908 2:50720844-50720866 CTCAGGTTTCAGTGATGGGGTGG - Intronic
934554180 2:95278674-95278696 GACACTGGGCAGAGATGGGGAGG + Intronic
936609926 2:113992229-113992251 CTCACTGTACAGTCATGGGGTGG - Intergenic
937249084 2:120512047-120512069 CTCGCTGTCCAGGGCTGGGGAGG + Intergenic
937316569 2:120935476-120935498 CCCACAGCCCAGAGATGGGGAGG - Intronic
937373297 2:121317616-121317638 GCAACTGTACAGAGATGGGGAGG - Intergenic
938127098 2:128682454-128682476 CTTGCTGTGCAGAGAGGGGGTGG + Intergenic
941735442 2:168970078-168970100 CTCATTGTCCAGAGCTGAGGTGG + Exonic
942189341 2:173455457-173455479 CTCACAATTCAGTGAAGGGGTGG + Intergenic
945480337 2:210337771-210337793 CTTACTCTTCAGAGCTGGTGAGG + Intergenic
946124635 2:217551839-217551861 CTGAAGGTTCAGAGATGTGGCGG - Intronic
946209718 2:218137782-218137804 CTGACTGTTCGGAGAGTGGGGGG + Intergenic
946411649 2:219518136-219518158 CTCCCTGCTCAGAGCTGTGGAGG + Intronic
946557257 2:220872494-220872516 CTCACTGTGCAGAAATGCAGAGG - Intergenic
1169652248 20:7882503-7882525 CTCACTTAGCAGACATGGGGAGG - Intergenic
1170813662 20:19695172-19695194 TTCCCTGTTCAAAGATTGGGGGG - Intronic
1173011835 20:39190151-39190173 CTCACAGATCAGTGATGGAGGGG + Intergenic
1173224890 20:41156636-41156658 CTCATGGTTCTGAGTTGGGGAGG + Intronic
1178021341 21:28411971-28411993 CTTACTGTTGGGAGATGGTGGGG - Intergenic
1178611713 21:34087979-34088001 GTTGCTGTTCTGAGATGGGGAGG + Intronic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1179060498 21:37974735-37974757 CTCATTGGTCAGAGATGGTTTGG - Intronic
1179286709 21:39983838-39983860 GTTAGTGTTAAGAGATGGGGAGG - Intergenic
1179588378 21:42388655-42388677 GTCACTGCTCTGTGATGGGGAGG - Intronic
1179598970 21:42462738-42462760 CTCACATTTCAGTGAGGGGGAGG + Intergenic
1179674857 21:42974497-42974519 ATCAATATTCAGAGAGGGGGCGG - Exonic
1183037655 22:35152293-35152315 TCCCCTGTACAGAGATGGGGGGG + Intergenic
1183716867 22:39538239-39538261 CTCAGAGTTCTGAGCTGGGGAGG - Intergenic
1184230267 22:43154951-43154973 GGCACCGTTCAGAGGTGGGGTGG + Intronic
1185162200 22:49236791-49236813 CTCAATGGACAGAGATGGCGTGG - Intergenic
949341785 3:3038412-3038434 CGCCCTGCTCAGAGCTGGGGTGG - Intronic
950162393 3:10770450-10770472 CTCACTGTTGAGGAAAGGGGTGG - Intergenic
950316086 3:12003583-12003605 CTCACTGGTCAGTGAGGAGGGGG + Intergenic
950785828 3:15434670-15434692 CTCACTGTTCAGAGATGGGGAGG + Intronic
953719879 3:45346141-45346163 GACACTGTTCAGAGATGGAGAGG - Intergenic
953778461 3:45843251-45843273 CTCACTAAACAGAAATGGGGAGG - Intronic
954659094 3:52217142-52217164 CTCTCTGTACAGAGTTGGGCTGG + Intergenic
957575119 3:81997181-81997203 CACAATGTTCAGAGATGAAGTGG + Intergenic
959989627 3:112616564-112616586 CTCAGTGGCCAGAGATGGGTAGG + Intronic
960991895 3:123317388-123317410 CTCAATTGTCAGTGATGGGGTGG + Intronic
961478893 3:127166931-127166953 TTCACTCTTCATGGATGGGGTGG + Intergenic
961780623 3:129318216-129318238 CGCAGTGTACAGAGATGGGATGG + Intergenic
962036464 3:131656868-131656890 CCAGCTATTCAGAGATGGGGAGG + Intronic
966087431 3:176085528-176085550 CTCACTGATCAGAGTGGTGGTGG + Intergenic
967448939 3:189600206-189600228 ATCACTGTTGGGAGAGGGGGTGG + Intergenic
968332965 3:197887416-197887438 AACACTGTTCAGTGATGGGAAGG - Intronic
968332989 3:197887513-197887535 AACACTGTTCAGTGATGGGAAGG - Intronic
977123162 4:93129884-93129906 CGTATTGTTCAGAGATGGAGTGG + Intronic
983057125 4:163111360-163111382 CTTTATGCTCAGAGATGGGGAGG - Intronic
983565525 4:169146949-169146971 TTCACTGTTCACAGTTGGGAAGG - Intronic
985717776 5:1472229-1472251 CTCCCTGTTCAGAGAGCTGGGGG + Intronic
986206725 5:5631451-5631473 CTCACTGTTTAGATATAGGATGG + Intergenic
989378552 5:40791052-40791074 CTCACTGCACAGTGATGGTGGGG - Intronic
989546842 5:42684616-42684638 CTCAGTGTTCTGAGAGGGGTTGG + Intronic
992578792 5:78149871-78149893 CTCTCCGCTGAGAGATGGGGTGG + Intronic
992848133 5:80775261-80775283 CTCTCTGTTCAGAATAGGGGAGG + Intronic
993522536 5:88921111-88921133 CTGAAAGTTCAGAGATGTGGTGG + Intergenic
997262666 5:132476506-132476528 GTCACTGGTCAGAGAAGGGAGGG + Intergenic
999583035 5:153060855-153060877 CTGGCACTTCAGAGATGGGGTGG - Intergenic
1001050861 5:168413235-168413257 ATCACCCTTTAGAGATGGGGTGG + Intronic
1003050881 6:2780331-2780353 CTTACTGGTTAGAGAAGGGGTGG + Intronic
1003371716 6:5534016-5534038 TACACTGTTCAGAGCTGGGAGGG + Intronic
1006068378 6:31478745-31478767 CTCACTGTACACAGATGGCCAGG - Intergenic
1007108021 6:39296701-39296723 CTCACCGGTCAGAGAGGGTGGGG + Intergenic
1008690246 6:53970967-53970989 CTCAATTTTCAGTAATGGGGAGG + Intronic
1009287486 6:61839105-61839127 CTCATTTTATAGAGATGGGGTGG + Intronic
1011166863 6:84458218-84458240 TTCCCAGTTCACAGATGGGGAGG - Intergenic
1012431181 6:99165084-99165106 CTCACTTTCCAGAAATGGGAAGG - Intergenic
1014534896 6:122603090-122603112 ATCACTGTTCAGAGTTGGGGTGG - Intronic
1015929832 6:138348039-138348061 CTGAGTGTTCAGGGATAGGGAGG - Intergenic
1016872276 6:148830167-148830189 CTCAAAGTTCAGACATGAGGAGG + Intronic
1017453538 6:154577023-154577045 CTCTCTCTTCAGCGATGGTGAGG - Intergenic
1018076196 6:160215799-160215821 CACACTGGCCAGAGATGGGAAGG - Intronic
1019064516 6:169285478-169285500 CTTTCTGTACAGATATGGGGGGG - Intergenic
1021651705 7:22839382-22839404 CTTAGTGTTCAGGGATGCGGGGG - Intergenic
1022694655 7:32692480-32692502 CTCACTACACAGAGATGGTGTGG - Intergenic
1022927836 7:35073980-35074002 CTCACTACACAGAGATGGTGTGG - Intergenic
1023243326 7:38173867-38173889 CTCTCTATTCAGAGATGGCATGG - Intergenic
1024575819 7:50763423-50763445 CACACTGTACAGGCATGGGGAGG + Intronic
1026148928 7:67771840-67771862 GTGACTTTTCAGAGAAGGGGAGG + Intergenic
1027733777 7:81907186-81907208 CTCACAGTTCAGGGATGGGGAGG + Intergenic
1027826086 7:83118488-83118510 CTCACTGCTGGGGGATGGGGTGG - Intronic
1028663477 7:93312730-93312752 ATCACTTTTCAGATATGTGGTGG + Intronic
1030862225 7:114648268-114648290 CTTAGTTTTCAGAGATGGGGGGG - Intronic
1031567690 7:123320768-123320790 CTCACTGTGCAGTGATGAAGTGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033550737 7:142445353-142445375 CTCACTGTCCAGAGAAGGGTAGG + Intergenic
1035119654 7:156555784-156555806 CCCACAATTTAGAGATGGGGGGG + Intergenic
1035628234 8:1089581-1089603 CCCACTGCTCAGAGTTGGGTTGG + Intergenic
1036234128 8:7023539-7023561 CTTCCTGTTCAGAGCAGGGGTGG + Intergenic
1036431227 8:8692708-8692730 ATTACTGTTCAGGGAAGGGGAGG + Intergenic
1037311480 8:17561105-17561127 CTTGATGGTCAGAGATGGGGTGG + Intronic
1038329787 8:26599007-26599029 CTCACTTTTCAGAGAAGAGCTGG + Intronic
1038863546 8:31414118-31414140 CTCAGTGTCCAGAGCAGGGGTGG - Intergenic
1038877304 8:31566089-31566111 CTCACTGTTGAAAGATTGGGGGG + Intergenic
1039272665 8:35899841-35899863 GACACTGATCAGAGATGGGATGG + Intergenic
1045189278 8:99866894-99866916 CTCACTCTTGATAGCTGGGGTGG + Intronic
1046339835 8:112839171-112839193 CTCATATTTTAGAGATGGGGTGG + Intronic
1048465298 8:134660530-134660552 CTATCTGTTCAGTGATGTGGTGG - Intronic
1049059637 8:140266535-140266557 CTCCTTGTCCAGAAATGGGGTGG + Intronic
1053553436 9:39108273-39108295 CTCACTCCCCAGAGAGGGGGGGG - Intronic
1054938370 9:70713343-70713365 CTCACTGACCAGAGAAGGGAAGG - Intronic
1054940061 9:70731336-70731358 CTCACTGACCAGAGAAGGGAAGG - Intronic
1055781827 9:79829007-79829029 CTCACCCTTCAGGGATGGAGAGG - Intergenic
1056472011 9:86914695-86914717 ATCAGTGTTCAGAGATGGACAGG + Intergenic
1058483046 9:105416389-105416411 CTCACAGTTGAGGGATGGAGAGG + Intronic
1059342917 9:113609653-113609675 TTCAGGGTTCAGAGGTGGGGCGG - Intergenic
1059374300 9:113870308-113870330 CTCCCTGTGCGGGGATGGGGAGG + Intergenic
1059384328 9:113952332-113952354 CTCAGTGTGCAGGGAAGGGGTGG - Intronic
1060394393 9:123305370-123305392 CTCACTGCTCACAGGTGGGCAGG - Intergenic
1060429574 9:123538602-123538624 CTCACTGACCAAAGATGGGAGGG + Intronic
1060488094 9:124062354-124062376 CTCCCATTTCACAGATGGGGAGG + Intergenic
1061949226 9:133926885-133926907 CCCACTGTGGAGGGATGGGGAGG + Intronic
1185615340 X:1418654-1418676 CCCACTGTCCAGGGCTGGGGTGG + Intronic
1186407101 X:9313728-9313750 CACACTGCTCAGAGAGGTGGTGG + Intergenic
1189485658 X:41429522-41429544 CTCACTGTTGAGCTGTGGGGAGG + Intergenic
1191883638 X:65866532-65866554 CTGAGTGTTCAGGGAGGGGGCGG + Intergenic
1197757101 X:130003019-130003041 CCCACTCTGCAGAGATGAGGAGG + Intronic
1201568851 Y:15393063-15393085 CTCACTCTTCAGGGTTGGGAGGG - Intergenic