ID: 950787786

View in Genome Browser
Species Human (GRCh38)
Location 3:15450328-15450350
Sequence GGGCCTGGTGGACCATCACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950787786_950787794 11 Left 950787786 3:15450328-15450350 CCAGGTGATGGTCCACCAGGCCC 0: 1
1: 0
2: 2
3: 13
4: 142
Right 950787794 3:15450362-15450384 CTGCTGAGTCCCCAAGACACAGG 0: 1
1: 0
2: 5
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950787786 Original CRISPR GGGCCTGGTGGACCATCACC TGG (reversed) Exonic
900229776 1:1550791-1550813 AGGCCTGGTGGTTCATCAGCAGG + Intronic
902302914 1:15515426-15515448 GTGCCTGGTGGACCATTGCATGG - Intronic
902412687 1:16220665-16220687 GGGTGTGGTGGGCCATTACCGGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
907243203 1:53091959-53091981 GGGCCAGGTGAACCAGCACTTGG - Intronic
912318671 1:108690164-108690186 GGGCCTGCTGGATGGTCACCAGG + Intergenic
915247988 1:154569487-154569509 GCGGCTGGTGGAGCATCTCCTGG + Exonic
919860179 1:201734747-201734769 GGGCCTGATGGACCCTCACCTGG - Intronic
920173699 1:204087258-204087280 GGGCCAGGCTGCCCATCACCTGG + Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920344330 1:205296318-205296340 GGGCCTTGTGAACCATTACATGG - Intergenic
920552810 1:206878355-206878377 GGTTCAGGTGGACCATCAGCTGG - Intergenic
1063501364 10:6557714-6557736 GGGGCTGGTGGAACATCACCTGG - Intronic
1069744268 10:70705182-70705204 GAGCCTGGTGGCCCAGCACCGGG - Intronic
1069906236 10:71734257-71734279 GGGCCTGGTGGACCGTGAGAAGG + Intronic
1076150413 10:128157766-128157788 AGGCCTCATGGACCATCACAAGG - Intergenic
1076243539 10:128928341-128928363 GGGCCGGGGGCCCCATCACCGGG + Intergenic
1076998156 11:309135-309157 GGGCCTGGACGACCAACACTGGG - Exonic
1077045030 11:540927-540949 GGGCAGGCTGGACCATCAGCAGG - Intronic
1077161525 11:1114882-1114904 GGGGCTGCTGTACCACCACCAGG + Intergenic
1077319813 11:1936118-1936140 GAGCCTGGAGGGCCATCACCAGG + Intronic
1077445612 11:2589258-2589280 GGCCCTGGAGGAGCAGCACCAGG + Intronic
1078210027 11:9263508-9263530 GGGCGCGGTGGCCCACCACCCGG - Intronic
1080406530 11:31984984-31985006 GTGCCTGGTGGCTCAACACCTGG - Intronic
1081532203 11:43969720-43969742 GGGCCCTGGGGACCAGCACCAGG - Intergenic
1082972394 11:59037356-59037378 GGGTCTGGTGTGCCATCATCTGG - Intronic
1084267293 11:68011657-68011679 GGGCCTGGGGGACCCCCATCAGG - Intronic
1084606808 11:70177110-70177132 GGGCCGGTTGGGCGATCACCTGG + Intronic
1092184136 12:6466283-6466305 GGGCCAGGGGGACCCCCACCTGG + Exonic
1092956321 12:13553585-13553607 GGTCCTGTTGGACCACCACCTGG + Exonic
1095291308 12:40483135-40483157 GGGACAACTGGACCATCACCTGG + Exonic
1096215247 12:49794852-49794874 CGGCCTGGTGGCCCAGCCCCAGG - Exonic
1096604182 12:52753273-52753295 GTGCCTGGTGGACAGTCACTGGG - Intergenic
1097037370 12:56132715-56132737 GGACCTCGTGTACCATCACCTGG - Exonic
1103034176 12:117642897-117642919 GGGCCTGGTTTCCCATCCCCTGG - Intronic
1103905606 12:124325931-124325953 GGGCCTGGTGGACCATCCAGGGG - Intronic
1105302929 13:19151749-19151771 GGGCCTGTATGACCCTCACCGGG + Intergenic
1106486719 13:30179204-30179226 TGGCCTGTTGGACCAAAACCTGG + Intergenic
1121432947 14:93900261-93900283 GGGGCAGGTGGACCAACCCCGGG - Intergenic
1122272226 14:100573420-100573442 GGGCCTCGTGCACCCTCATCAGG + Intronic
1122819781 14:104335577-104335599 GGGCCTGGTGGACCATGTGGAGG + Intergenic
1123459652 15:20458283-20458305 GGCCCTGGGGGACCATTCCCAGG - Intergenic
1123658410 15:22542137-22542159 GGCCCTGGGGGACCATTCCCAGG + Intergenic
1124265881 15:28234120-28234142 GGCCCTGGGGGACCATTCCCAGG - Exonic
1124312275 15:28636629-28636651 GGCCCTGGGGGACCATTCCCAGG + Intergenic
1129737116 15:77972690-77972712 GGGCCTGGAGGACAGGCACCTGG - Intergenic
1129848964 15:78780945-78780967 GGGCCTGGAGGACAGGCACCTGG + Intronic
1130764724 15:86858316-86858338 GGGCCTTGTGGAACATCACTGGG + Intronic
1135693327 16:24563636-24563658 CAGCCTGGTCGACCACCACCTGG - Exonic
1136117138 16:28101619-28101641 GGGACTTGTGGACCAGGACCTGG + Exonic
1136424551 16:30160819-30160841 GGGCGTGGTGGTGCATAACCGGG + Intergenic
1137002822 16:35246162-35246184 GGACCTGCTGCACCAACACCTGG + Intergenic
1137016723 16:35384382-35384404 GGACCTGCTGAACCAACACCTGG + Intergenic
1139726901 16:68907491-68907513 GGGCCGGGTGGAGCATCTCGGGG + Exonic
1140468976 16:75204368-75204390 GGGCCTAGGGGACCCTGACCTGG + Intronic
1140473613 16:75227922-75227944 GGGCCTGGGAGACCCTAACCTGG - Intergenic
1141266520 16:82502727-82502749 GGGCCTGGTGGGCCAAGAGCAGG + Intergenic
1143277420 17:5722076-5722098 GGGCATGGTGGACCGTTACACGG + Intergenic
1143286567 17:5794228-5794250 GGGCCTGGAGGACCAGCCCAAGG - Intronic
1143568974 17:7742567-7742589 GGGCCTGGTGGACTACGCCCAGG + Intronic
1144654670 17:17028093-17028115 GGAGCTGCTGGACCATCACAGGG + Intergenic
1146685296 17:34837381-34837403 GGGCCTGGTAGAACATCTTCAGG - Intergenic
1147621682 17:41872204-41872226 TGGCCTTGTCGACCATCTCCTGG - Intronic
1150069616 17:62139909-62139931 GGCCGTGGTGGACCACCAGCAGG + Intergenic
1153223632 18:2881973-2881995 GGGCCTTCTGGAACATCTCCAGG + Intronic
1155266826 18:24102678-24102700 GGGCCAGGTGTACAATCTCCAGG - Intronic
1155514374 18:26609459-26609481 AGACATGGTGGTCCATCACCCGG - Intronic
1159079865 18:63724879-63724901 GGGCCTGGTAGACAATCACTGGG - Intronic
1160895868 19:1401548-1401570 GGGCCTGTTGGACCCGCCCCCGG - Exonic
1161068570 19:2249716-2249738 GCGCCTGGTGGTCCTACACCTGG + Exonic
1163303130 19:16460589-16460611 GGGCAAGGTTGTCCATCACCAGG - Intronic
1163595124 19:18216839-18216861 GGTGCTGGAGAACCATCACCTGG - Exonic
1163987573 19:20968001-20968023 GGGCATGGTGGCCTATCGCCAGG + Intergenic
1164233896 19:23315505-23315527 GGCCCTTGTGGACAATAACCAGG - Intronic
1166609283 19:44175299-44175321 GAGCTTGGTGGACCATCTCTTGG + Intronic
926910430 2:17847874-17847896 GGGGCTGGTGGATTAGCACCTGG - Intergenic
927692050 2:25215412-25215434 GGGCCTGGAGGAGCCTCCCCTGG - Intergenic
928024725 2:27730250-27730272 AGGCCTGGTGGAGCAGCATCTGG - Intergenic
932412574 2:71555973-71555995 GGGCCAGGTGGACCTGCTCCAGG - Exonic
934655725 2:96116134-96116156 GGTCCTGGTGGTCCATGACGGGG + Exonic
934686856 2:96327480-96327502 GTGCCTGGTGCACCACCACAGGG + Exonic
936654785 2:114472430-114472452 GGGCCTATTGGCCTATCACCAGG + Intronic
938127445 2:128684753-128684775 AGGCCTGGGGGACCCCCACCAGG + Intergenic
942086940 2:172452522-172452544 GAGCCTGGTGGACCAGCTCCAGG + Intronic
948453131 2:238091006-238091028 GGGCCTCGTTGACCTTCACTGGG + Intronic
948789724 2:240371070-240371092 GGGCCACGTGGACCATCCACAGG + Intergenic
1172240945 20:33412233-33412255 GGCCCTGCTGGAGCATCTCCTGG + Intronic
1174867472 20:54151353-54151375 GGGACTGATGGAGAATCACCAGG + Intergenic
1175203003 20:57290852-57290874 GGGCCAGGTGGAGCAGCAGCAGG - Intergenic
1175414811 20:58794335-58794357 GGGCCTGGTGACCCTTCTCCTGG - Intergenic
1176312172 21:5157914-5157936 GGACCTGGAGGCCCATCAGCCGG - Intergenic
1176965533 21:15208201-15208223 GGGCATGGGGGACGAACACCTGG - Intergenic
1177651395 21:23965218-23965240 GGGCTTGGAGGGCCAACACCAGG + Intergenic
1178710566 21:34912886-34912908 GGGGCTGGGGGGCCTTCACCTGG + Intronic
1179844876 21:44104116-44104138 GGACCTGGAGGCCCATCAGCCGG + Exonic
1181541561 22:23575751-23575773 GGGCCTTGTTGACCATGGCCTGG - Intronic
1181551436 22:23641088-23641110 GGGCCTTGTTGGCCATGACCTGG - Intergenic
1181796824 22:25317554-25317576 GGGCCTTGTTGGCCATGACCTGG + Intergenic
1182430246 22:30294927-30294949 GGGCCTGGTGGTACCTCAGCAGG + Exonic
1183623765 22:38989571-38989593 GGTCCTGATGGACCAGCACATGG + Exonic
1184293982 22:43512393-43512415 GGGCCTGCTGGGGCATCTCCTGG - Intergenic
950122138 3:10488936-10488958 GGGTCTCGTGGGCCATCACAGGG - Intronic
950416647 3:12872746-12872768 GGGCCTTCTGGACCTTCATCAGG - Intergenic
950787786 3:15450328-15450350 GGGCCTGGTGGACCATCACCTGG - Exonic
954902337 3:54030756-54030778 GGGCCTGGTAGAGCATCATGAGG - Intergenic
957974550 3:87426635-87426657 GGGCCTGGTGGGCCATGATTGGG - Intergenic
959566587 3:107838890-107838912 GGGCCTGGTACCTCATCACCTGG - Intergenic
961325786 3:126108507-126108529 GGGGTTGGGGGAGCATCACCAGG - Intronic
962867767 3:139461817-139461839 GGGCAAGGTGGAACATCACAGGG - Intronic
967527077 3:190507498-190507520 GGCACTGGAGGAGCATCACCAGG + Intergenic
968811246 4:2800571-2800593 GGGCCAGGTGGCACTTCACCTGG + Intronic
968901414 4:3433672-3433694 GGGCGTGGTGGAGCACCACGTGG - Intronic
968974360 4:3813369-3813391 GGGCTTGGATGACGATCACCCGG + Intergenic
969090552 4:4690851-4690873 GGGACTGGTGGGGCATCAGCTGG + Intergenic
969176450 4:5402608-5402630 TGTCCTGGTGGCACATCACCTGG + Intronic
969269258 4:6087886-6087908 GATGCTGGTGGATCATCACCAGG - Intronic
969663234 4:8542635-8542657 GGGCCTTGTGCACAATCACCTGG - Intergenic
969736296 4:8993141-8993163 GGGCTTGGTGGCCCAGCACTAGG - Intergenic
973956507 4:56068405-56068427 GGGCCTGGAGGGCCATCAGAAGG + Intergenic
985992234 5:3572866-3572888 GGGGCTGGTGCACCAGCAGCAGG - Intergenic
986754909 5:10826526-10826548 TGGACCGGTGGACCATCACCAGG - Intergenic
987255216 5:16143449-16143471 TGGCCTGGTGAACCAGCACCTGG - Intronic
993017601 5:82552683-82552705 GGGTCAGGTGCAACATCACCTGG - Intergenic
997110102 5:131065489-131065511 GGGCCTGGTGGGAGATCACAGGG + Intergenic
999115900 5:149163066-149163088 GGGCCTTGTGGACCATGGCCAGG + Intronic
1002181682 5:177434066-177434088 TGGCCTGGAGGACCTGCACCGGG + Exonic
1004266679 6:14154119-14154141 GGGCCTGATGGACAATAAGCAGG - Intergenic
1006092235 6:31634906-31634928 GAGCCAGGTGGACCCTCACAAGG - Exonic
1006151407 6:31992112-31992134 GGTGTTTGTGGACCATCACCTGG + Exonic
1006157708 6:32024850-32024872 GGTGTTTGTGGACCATCACCTGG + Exonic
1015215130 6:130741254-130741276 GGGCATGGAGGATCATCTCCAGG - Intergenic
1016987186 6:149904442-149904464 GGGCCTGGTAGGCTGTCACCTGG - Intergenic
1021852808 7:24825041-24825063 GGGCGTTGTGGACCATGGCCAGG + Intronic
1022836886 7:34126342-34126364 GGGACTTGTGGACCATGACTAGG + Intronic
1024152809 7:46590012-46590034 GGGCCTGATGGTCCAGCCCCTGG + Intergenic
1027185045 7:75965984-75966006 GGGCCCAGTGGCCCAGCACCCGG - Intronic
1027263163 7:76479284-76479306 GGGCCTGGTGGCCGGTCAGCAGG + Intronic
1027314547 7:76977389-76977411 GGGCCTGGTGGCCGGTCAGCAGG + Intergenic
1031235287 7:119168315-119168337 GGGCCAGGTGGACCAACTCTTGG + Intergenic
1032844635 7:135742014-135742036 GGGCCTGGTGGACCAGTGCAGGG - Intronic
1033599491 7:142878391-142878413 GGTCCTGTTTGACCCTCACCAGG + Intronic
1034439332 7:151078654-151078676 GGGCCAGGAGCACCATCACGTGG + Exonic
1035256525 7:157632289-157632311 TGGCCTGGTGCACCAACGCCTGG + Intronic
1040829702 8:51663261-51663283 GGGCCTGCTGGTCCATCACTGGG - Intronic
1047741459 8:127810132-127810154 GGGCCTGGGGGGCCACCCCCTGG + Intergenic
1048920516 8:139225780-139225802 GAGCCTGCTGGACCTTCCCCCGG + Intergenic
1049256955 8:141619271-141619293 GGGCCTGAAGAACCATCACTAGG - Intergenic
1049671653 8:143872758-143872780 GGGCCTGGTGGACCCCGCCCAGG - Exonic
1049671714 8:143872986-143873008 GGGCCTGGTGGACCTCGCCCGGG - Exonic
1056238361 9:84618542-84618564 GGGCCTGGTGGACCCTCCATAGG - Intergenic
1060894721 9:127210260-127210282 GGGCCTGGGGGTCATTCACCAGG - Intronic
1061932801 9:133841966-133841988 GGGCCGGGTGGACCATCTGTGGG - Intronic
1062460910 9:136662224-136662246 GGGCCTGCTTGCCCATCTCCAGG + Intronic
1185557327 X:1031725-1031747 GGGCCTGGTCCACCAGCAGCAGG + Intergenic
1189846325 X:45141954-45141976 GGTCTTGGAGGACCATTACCTGG + Intergenic
1192162712 X:68800545-68800567 GGGCCTGGCCGACCATAACTTGG - Intergenic
1195639989 X:107162823-107162845 GGGCCTGGGGGAGGATCATCAGG + Intronic
1196049151 X:111287142-111287164 GGCTCTGGAGGAGCATCACCAGG - Intergenic