ID: 950787801

View in Genome Browser
Species Human (GRCh38)
Location 3:15450410-15450432
Sequence CCCAAGGGTGTCCCTCCAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950787797_950787801 14 Left 950787797 3:15450373-15450395 CCAAGACACAGGCTCATTAAATA 0: 1
1: 0
2: 1
3: 18
4: 228
Right 950787801 3:15450410-15450432 CCCAAGGGTGTCCCTCCAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 135
950787793_950787801 26 Left 950787793 3:15450361-15450383 CCTGCTGAGTCCCCAAGACACAG 0: 1
1: 0
2: 1
3: 25
4: 250
Right 950787801 3:15450410-15450432 CCCAAGGGTGTCCCTCCAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 135
950787795_950787801 16 Left 950787795 3:15450371-15450393 CCCCAAGACACAGGCTCATTAAA 0: 1
1: 0
2: 5
3: 30
4: 357
Right 950787801 3:15450410-15450432 CCCAAGGGTGTCCCTCCAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 135
950787796_950787801 15 Left 950787796 3:15450372-15450394 CCCAAGACACAGGCTCATTAAAT 0: 1
1: 0
2: 1
3: 39
4: 500
Right 950787801 3:15450410-15450432 CCCAAGGGTGTCCCTCCAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 135
950787792_950787801 30 Left 950787792 3:15450357-15450379 CCAGCCTGCTGAGTCCCCAAGAC 0: 1
1: 1
2: 1
3: 21
4: 207
Right 950787801 3:15450410-15450432 CCCAAGGGTGTCCCTCCAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950787801 Original CRISPR CCCAAGGGTGTCCCTCCAGC TGG Exonic
900519301 1:3098002-3098024 TCCAATGGTGCTCCTCCAGCAGG + Intronic
901053398 1:6437248-6437270 CCCAGGGGTGCCCAGCCAGCCGG - Intronic
901511260 1:9719083-9719105 GCCCAGAGTGTCCCTCGAGCAGG - Intronic
902476809 1:16692743-16692765 CCCACGGGTGGCTGTCCAGCCGG + Intergenic
902822293 1:18950740-18950762 CCCCAGGGGGGCCCTCAAGCAGG - Intronic
903669678 1:25028091-25028113 CCCATGGATGTGCCTCCAGGGGG + Intergenic
905263958 1:36738485-36738507 CCCCACCGTCTCCCTCCAGCAGG - Intergenic
906566666 1:46805909-46805931 CCTAAGGGTGTCCATCCTGAAGG + Intronic
907162541 1:52381814-52381836 CCCAAGGGTGACTTTCCACCTGG - Intronic
911168505 1:94746096-94746118 CCCAAGGGTATCTCCCCAGTAGG - Intergenic
911359965 1:96863617-96863639 CCCAAGGGACTCCCTCTTGCAGG - Intergenic
912936957 1:114012094-114012116 CCCAAGGCTGTCCCTCCTCCTGG + Intergenic
915517076 1:156419939-156419961 CCCAGGCCTCTCCCTCCAGCGGG - Intronic
917132169 1:171754547-171754569 TCCAAATGTCTCCCTCCAGCAGG + Intergenic
924539742 1:244970283-244970305 CCCAAGGGTCTTCCTCCCCCGGG + Exonic
1065847975 10:29761908-29761930 CCCAAATCTGTCTCTCCAGCTGG + Intergenic
1067146543 10:43698286-43698308 CCCAAGGGTGACCCTGCTGCTGG + Intergenic
1073423182 10:103440617-103440639 CTCATGGCTGTCCCTCCAGGAGG - Intronic
1078568749 11:12439552-12439574 CCCAGGCCTGTCCCTTCAGCTGG - Intronic
1080213876 11:29818842-29818864 CCCAAGCCTGTTCTTCCAGCTGG - Intergenic
1081852902 11:46285961-46285983 CCCATGGGTTCCCCTCCACCTGG + Intronic
1085401938 11:76240782-76240804 GCCAAGTATGTCCCTCCACCCGG - Intergenic
1089495731 11:118907914-118907936 CCCAAAGGGCTCCCACCAGCCGG + Intronic
1089830220 11:121320830-121320852 CCCAAGGGCGACCCTCCTGAAGG + Intergenic
1092628528 12:10354413-10354435 CCCAACGGAGACCCTCCAACAGG - Intergenic
1094826721 12:34275284-34275306 CCCAAGGGTGTCCCTGGAGTGGG - Intergenic
1096802002 12:54116611-54116633 CCCAAGGTTGTACAGCCAGCAGG - Intergenic
1100980774 12:100160723-100160745 ACCAAGGCTGTCCCTGCACCTGG + Intergenic
1102229865 12:111255203-111255225 CCCCTGGGTGACCCTCCAGAGGG + Intronic
1102506808 12:113389036-113389058 CCCACGGGTGGCCCTGGAGCTGG + Exonic
1102730225 12:115102661-115102683 TCCAAGGGTGTCTCTCCAGATGG + Intergenic
1103440273 12:120957808-120957830 CCCAAGGGGATCACACCAGCTGG + Intergenic
1103792908 12:123484199-123484221 CCCGAGGACGTCCCCCCAGCCGG - Exonic
1106207457 13:27613254-27613276 CCAAAAGGTGTCCCTGCAGCAGG + Intronic
1108113550 13:47103204-47103226 CCCAAGTGAGACCCTCCAACAGG + Intergenic
1111123283 13:83880865-83880887 CCCAAGGGTTATCCTCTAGCAGG + Exonic
1113442198 13:110337737-110337759 CCCAGGGAAGTCCCTGCAGCAGG + Intronic
1119174549 14:72559655-72559677 CCCAAGGGTGGCCCCTAAGCTGG + Intronic
1119978661 14:79054628-79054650 CCCCAGTCTGTCTCTCCAGCTGG - Intronic
1120620496 14:86757599-86757621 CCTCAGGTTGTTCCTCCAGCTGG - Intergenic
1121323105 14:93004189-93004211 CACCAGGGTGTGCCTCCTGCTGG - Intronic
1202859574 14_GL000225v1_random:72824-72846 CTCCAGGGGGACCCTCCAGCTGG + Intergenic
1124628823 15:31326105-31326127 CCCGAGTCTGTCCCTCCCGCGGG + Intergenic
1129856273 15:78827575-78827597 TCCCAGGGTTTCCTTCCAGCAGG - Intronic
1132566974 16:628021-628043 CCCAAGTGCGTCCCCGCAGCTGG - Exonic
1138360177 16:56421954-56421976 CCCAAGGGGGCCTCTCCAGGTGG - Intronic
1139299932 16:65936234-65936256 CCCAATGGCCTCCCTCAAGCCGG - Intergenic
1139674325 16:68512513-68512535 CACAAGACTGTCCCTTCAGCGGG + Intergenic
1141064484 16:80902777-80902799 CCCAACTGTCTCCCTCCAGGAGG - Intergenic
1141727347 16:85798971-85798993 CCCAGCGGTCGCCCTCCAGCAGG - Intronic
1142218601 16:88841862-88841884 CCCAAGGGTGTCCCTGGAGGCGG + Intronic
1143764461 17:9128446-9128468 CCCATTTCTGTCCCTCCAGCTGG - Intronic
1143864921 17:9916866-9916888 CCCAAGGCTCTTCCTCCAGCTGG - Exonic
1148731886 17:49841806-49841828 CCCAAGGATGCCCACCCAGCTGG - Intronic
1152700252 17:81815059-81815081 CCCCGGGGGGTCCCTGCAGCAGG + Intergenic
1153741990 18:8138733-8138755 TGCAAGGGCTTCCCTCCAGCAGG + Intronic
1158588431 18:58760266-58760288 CCCCAGGGTGTCCCAGCAGAAGG - Intergenic
1160579051 18:79873397-79873419 CCCACGGGTGCCGCTCCTGCCGG + Intronic
1160599703 18:80003210-80003232 GCCTAGGATGTCCATCCAGCTGG + Intronic
1160929534 19:1563657-1563679 CACAGGCGTCTCCCTCCAGCCGG - Intronic
1161310135 19:3589497-3589519 CCGCAGGGTCTCCCTCCCGCTGG - Exonic
1162421823 19:10569764-10569786 ACCATAGGTGTCCCTGCAGCAGG - Intergenic
1162496053 19:11023972-11023994 CCCAGGGGTGTGGCTGCAGCAGG - Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1162958447 19:14112681-14112703 CCCGAGGGTGTCCCTCTGGCTGG + Intronic
1163130796 19:15271649-15271671 CCCAACAGTCTCCCTCCCGCAGG + Intronic
1163837594 19:19584502-19584524 CTGAAGGGTGTCCCTACAGCTGG + Intronic
1165782884 19:38444067-38444089 CCCAGGGCTCTCCCTCCACCAGG - Intronic
1168270751 19:55248517-55248539 GCCAAGGGTGCCTCTCCCGCAGG + Intronic
1202710824 1_KI270714v1_random:18567-18589 CCCACGGGTGGCTGTCCAGCCGG + Intergenic
1202714915 1_KI270714v1_random:36820-36842 CCCAGGGGTGCCCAGCCAGCCGG + Intergenic
926715563 2:15921286-15921308 GCCAAGTGTATTCCTCCAGCTGG - Intergenic
927407775 2:22791675-22791697 CTCAAAGGTGTAGCTCCAGCAGG + Intergenic
939925532 2:148169574-148169596 GCTAAGGGTATCTCTCCAGCTGG - Intronic
948684902 2:239664344-239664366 CCCTGGGGTGTCCCTCTACCTGG - Intergenic
948738869 2:240029997-240030019 CCCGGGGCTGTGCCTCCAGCTGG - Exonic
948740943 2:240045640-240045662 CCCGGGGCTGTGCCTCCAGCTGG - Exonic
1169970231 20:11261821-11261843 CCCTGGGGTTTCCCACCAGCAGG - Intergenic
1171486917 20:25491812-25491834 CCCAAGGTGGCCCCTCCACCCGG + Intronic
1171493341 20:25537679-25537701 CCCAGGGCTGTCCCTCCAGAGGG - Intronic
1171853750 20:30326411-30326433 CCCAAGGTTGTACAGCCAGCAGG - Intergenic
1172096542 20:32463323-32463345 CTCAAGGGTGACCCTCCTGGAGG - Intronic
1172707912 20:36896359-36896381 CCCACGGGTGTCACTCTAGTTGG + Intronic
1173060005 20:39651712-39651734 GCCCAGGGTTTCCCTCCAGGAGG - Intergenic
1175993896 20:62804010-62804032 CCCCAGGGTGACCCTCCCGGTGG + Intergenic
1178913903 21:36696599-36696621 CCCGAGGCTCCCCCTCCAGCAGG + Intergenic
1179572703 21:42287253-42287275 CCCTAAGGTCTCCCTCCACCTGG - Intronic
1180967258 22:19797173-19797195 CCCAAATGTGTCCATCCATCGGG + Intronic
1182090050 22:27588405-27588427 GCCGAGGGTGTGTCTCCAGCTGG - Intergenic
1182464321 22:30505242-30505264 CCCAAGGCTGCCCCCGCAGCCGG + Intronic
1182537899 22:31019683-31019705 CACATCGGTGTCCCACCAGCAGG - Intergenic
1184870876 22:47237849-47237871 CCAAAGGATGTCCCTCCACATGG - Intergenic
950416037 3:12869465-12869487 CCCTAGAGTGTTCCTGCAGCAGG + Intronic
950630099 3:14276610-14276632 AGCAGGGGTGTCCCTGCAGCTGG + Intergenic
950787801 3:15450410-15450432 CCCAAGGGTGTCCCTCCAGCTGG + Exonic
951339169 3:21463479-21463501 CCCAGGTGTGTGCCTCCACCTGG - Intronic
953234692 3:41095905-41095927 CCCACGGGTGTAGCGCCAGCTGG + Intergenic
953766298 3:45746448-45746470 TCCAGGGGTATCCCTGCAGCAGG - Intergenic
954107073 3:48415160-48415182 CCCAAGGGTGTCCTACTTGCTGG + Exonic
954577902 3:51686821-51686843 CCCAGGGGTGCCCCTCCAGATGG - Intronic
956174075 3:66456930-66456952 CACCAGGGAGTGCCTCCAGCTGG - Intronic
965165455 3:165190128-165190150 TCCAAGGGTTTTCTTCCAGCTGG + Exonic
966899412 3:184469546-184469568 CCCAAGGGAGCGCCTCCACCTGG - Intronic
968808969 4:2791717-2791739 CCCAAGTGTGTCTCTCCAGCAGG + Intergenic
968878877 4:3288489-3288511 CCCATGGGTGTCCCTTGAGGTGG + Intergenic
969028429 4:4192626-4192648 CCCAAGGTTGCCCCTCCTCCAGG + Intronic
973126088 4:46586726-46586748 CCCCAGGGTGTCCCTGCATAGGG + Intergenic
975828235 4:78341832-78341854 TCCCAGAGTGTCTCTCCAGCAGG + Intronic
976447854 4:85152162-85152184 ACTGAGGGTGTCTCTCCAGCTGG - Intergenic
986177373 5:5363831-5363853 CCCAGGTGTGTCCCTGCAGTTGG - Intergenic
998005910 5:138656980-138657002 CCCTATGCTGTCCCTCCTGCTGG + Intronic
998860553 5:146439462-146439484 CCCCAAGATGTCCTTCCAGCTGG - Intergenic
1000368439 5:160512070-160512092 CCCAAAGCTGTCCCTCAAGGAGG + Intergenic
1001832725 5:174803127-174803149 GCTAAGGATGTCCATCCAGCTGG + Intergenic
1001990743 5:176113685-176113707 CACTGGGGGGTCCCTCCAGCAGG - Intronic
1002226130 5:177724455-177724477 CACTGGGGGGTCCCTCCAGCAGG + Intronic
1007105464 6:39280461-39280483 CCCCAGGGAGCCCCTGCAGCAGG - Intergenic
1007712522 6:43833773-43833795 CCCAGGGCTGTCTCTCCAGTTGG + Intergenic
1012335040 6:98045008-98045030 CCCCAGGGTATACCTCCAGCAGG - Intergenic
1013661300 6:112299511-112299533 CCCAAAGGGGTCCCAACAGCAGG - Intergenic
1016869703 6:148804421-148804443 ACCAAGGGTGGCCTTACAGCAGG - Intronic
1019300707 7:302133-302155 CCCAAGGGTGTCTGCCCAGCTGG + Intergenic
1022105121 7:27191816-27191838 CCCAGGAGAGTCTCTCCAGCAGG + Intergenic
1022207523 7:28179560-28179582 CCTGGGGGTGTCTCTCCAGCGGG + Intronic
1023931138 7:44707406-44707428 CATCAGGGTGTCCCCCCAGCGGG + Intronic
1024481243 7:49865697-49865719 CCTAAGGGTGTGCCTTCAGAAGG + Intronic
1024812069 7:53223616-53223638 CCCCACAGTGTCCCTCCTGCAGG + Intergenic
1026307361 7:69153613-69153635 TCCAAGTGGGTCCTTCCAGCAGG + Intergenic
1036030262 8:4963114-4963136 CCCATGGGTGGCCCTCCTACAGG + Intronic
1048998094 8:139806551-139806573 CCCAAGGGTGTACCTGAACCGGG + Intronic
1049293167 8:141814582-141814604 CCCAAGGGTGTGCCATCTGCTGG - Intergenic
1049293520 8:141817060-141817082 CCCACGTGTCTCCCTCCAGGAGG + Intergenic
1049546225 8:143232668-143232690 CCACAGGCTCTCCCTCCAGCGGG - Intergenic
1049671859 8:143873545-143873567 TCCAGGGCTGTCCCTCCCGCAGG + Intronic
1053791548 9:41689704-41689726 CCCAAGGTTGTACAGCCAGCAGG - Intergenic
1054153609 9:61625067-61625089 CCCAAGGTTGTACAGCCAGCAGG + Intergenic
1054473391 9:65556195-65556217 CCCAAGGTTGTACAGCCAGCAGG + Intergenic
1057424992 9:94941155-94941177 CCCAAGGGTTGCCCTTCAGAGGG - Intronic
1057613256 9:96566518-96566540 CCCAAGGATCTCGCTCCCGCGGG + Intronic
1058097536 9:100880078-100880100 CCCAAGGTTATCCCTCCACAGGG + Intergenic
1059240952 9:112804788-112804810 CCCAACGGTGGTACTCCAGCAGG + Exonic
1060742341 9:126107518-126107540 CCCCAGGCTGTCTCCCCAGCAGG - Intergenic
1061042203 9:128146686-128146708 CCCCAGGGTGTCCCTACACAAGG - Intergenic
1061290613 9:129648744-129648766 CCCAAGAGTGTCCCTGCAGGAGG + Intergenic
1062069410 9:134547481-134547503 ACCAAGGCTGTCACTCCAGGCGG - Intergenic
1062531388 9:137002233-137002255 GCCAGCGGTGCCCCTCCAGCAGG - Intergenic
1189922313 X:45914586-45914608 CCCATGTGTGGCCCTGCAGCAGG - Intergenic
1192180523 X:68912985-68913007 CTCAGGGGTGTCTCCCCAGCTGG + Intergenic
1200047458 X:153410418-153410440 CCCAAGCTTGTCCCTTCACCGGG - Intergenic
1200692308 Y:6318760-6318782 ACCCAGGGTATCCCTTCAGCAGG - Intergenic
1201042964 Y:9855967-9855989 ACCCAGGGTATCCCTTCAGCAGG + Intergenic