ID: 950792058

View in Genome Browser
Species Human (GRCh38)
Location 3:15479847-15479869
Sequence TAGTACCCACAAATTGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950792058_950792061 10 Left 950792058 3:15479847-15479869 CCATGGTCAATTTGTGGGTACTA 0: 1
1: 0
2: 0
3: 6
4: 62
Right 950792061 3:15479880-15479902 AATTTTTGCCTTTCTTCAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950792058 Original CRISPR TAGTACCCACAAATTGACCA TGG (reversed) Intronic
908383812 1:63621357-63621379 AAGTACCCCCAAATTTACCCTGG + Intronic
922537944 1:226396628-226396650 TACTACCTACTAATTGTCCAGGG - Intronic
1068175477 10:53451550-53451572 CAGCACACACAAATTGACCCTGG - Intergenic
1069184717 10:65409002-65409024 TGGGACCAACAAATTGGCCAGGG + Intergenic
1072497703 10:95978741-95978763 TAGTACGCAGAAATTCACCCAGG - Intronic
1074873350 10:117595201-117595223 TAGTACCCACACCCTGGCCAAGG + Intergenic
1078406606 11:11075448-11075470 TAATATCACCAAATTGACCATGG + Intergenic
1089058393 11:115606502-115606524 TAGTACCAATAAATTTAACATGG - Intergenic
1091160970 11:133419630-133419652 TTGTAGCCTAAAATTGACCATGG + Intronic
1094874323 12:34623868-34623890 GAGTACACACTAATTTACCAGGG - Intergenic
1099538761 12:83878431-83878453 TAGTTCCTCCAAAGTGACCATGG - Intergenic
1105028342 12:132864998-132865020 TAGTAGCCACAAAATGCACATGG + Intronic
1106973608 13:35177405-35177427 TAGTACCTGCAAATGGAGCAAGG - Intronic
1109108272 13:58282858-58282880 TAGTACCCGCAAGTTATCCATGG - Intergenic
1116612334 14:47091851-47091873 TAGCAGCCACAAATTGAAGATGG + Intronic
1118469161 14:66058669-66058691 TAGCAGCCACAAATAGAACATGG - Intergenic
1124377560 15:29137943-29137965 CATTTCCCACAGATTGACCACGG - Intronic
1126516061 15:49539427-49539449 CAGTGCCCACAAAATGGCCATGG + Intronic
1140612757 16:76621013-76621035 TAGAAAACACAAATTGAGCATGG - Intronic
1141966444 16:87447964-87447986 TTGTACACACAGATTGTCCAGGG - Intronic
1149342062 17:55697665-55697687 TAGTTCCCCCAAATTCACAAGGG + Intergenic
1155356945 18:24962094-24962116 TAGAACCCACATAGTGAGCATGG - Intergenic
1159820480 18:73135601-73135623 TAGTTCCCACAAATAGACAAGGG - Intergenic
1167916822 19:52747079-52747101 TAGCACACACTAATTTACCAGGG - Intergenic
929263627 2:39894394-39894416 TAGTCCTCACACATTGACCAAGG - Intergenic
938099021 2:128485596-128485618 TGGTACCCTTAAATGGACCATGG - Intergenic
939880905 2:147630258-147630280 TAGTACCCAAAAAATAAACATGG + Intergenic
940125558 2:150319441-150319463 TAGTAGCTTGAAATTGACCATGG - Intergenic
940754118 2:157661947-157661969 TTGTAACCACAAATTGCCCATGG + Intergenic
944702337 2:202257271-202257293 AACTACCCACAAAGTAACCAAGG + Intergenic
945106236 2:206317984-206318006 CAGTAACCCCAAATTGCCCAGGG + Intergenic
946936626 2:224728493-224728515 TAGTATACACAAAATGACAATGG + Intergenic
1171984503 20:31650260-31650282 TAGTCCACACAGAGTGACCATGG - Intergenic
1174480313 20:50826664-50826686 TAGTACTGACAAATGTACCATGG - Intronic
1177949320 21:27514219-27514241 TATAACCCACAAAATGACCTAGG + Intergenic
1180052578 21:45338401-45338423 AGGTAGCCACAACTTGACCATGG + Intergenic
950391467 3:12700202-12700224 TAGGACCCACTAGTTGACCCTGG + Intergenic
950792058 3:15479847-15479869 TAGTACCCACAAATTGACCATGG - Intronic
950849210 3:16046392-16046414 TAGTAGCTTGAAATTGACCATGG + Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
957513815 3:81224804-81224826 TAGTACTTACAAATTGAACTAGG - Intergenic
967887415 3:194342471-194342493 CAGTAACCCCAACTTGACCAAGG - Exonic
968863591 4:3192831-3192853 GAGTATCCTCAAATGGACCAAGG - Intronic
972461038 4:39302589-39302611 TAGCACCCTGAAATTGACAAGGG + Exonic
972962059 4:44465219-44465241 TAGTTGCCACTAATTGTCCAGGG - Intergenic
976999081 4:91473005-91473027 TAGTAACCACAACTTAACCAGGG - Intronic
979538205 4:121849142-121849164 TGGTACCCACAAATATACTAGGG - Intronic
981509437 4:145539553-145539575 CAGTATTCACAAATTGCCCAAGG - Intronic
983261077 4:165457249-165457271 TAGTAGCTTCAAATTGGCCAGGG + Intronic
983858892 4:172679434-172679456 TATGACCCACAAATTTAGCATGG - Intronic
985374757 4:189323163-189323185 TAGTACATACTAAGTGACCATGG + Intergenic
993562576 5:89429191-89429213 TAGTTTCCACAAGTTTACCATGG + Intergenic
996563467 5:124855646-124855668 TAGGACCTCCACATTGACCATGG - Intergenic
1007514365 6:42399687-42399709 AAGTAACCAGAACTTGACCATGG + Intronic
1009915867 6:69995118-69995140 TAGTACCCACAAGTTAAACAAGG + Intronic
1015343887 6:132132730-132132752 TAGTACAAACAAATTTACTATGG + Intergenic
1018038331 6:159900357-159900379 AAGAATCCACAAAATGACCAAGG + Intergenic
1023002612 7:35826709-35826731 TAGTAACAAAAAATTGATCAAGG - Intronic
1031421265 7:121554186-121554208 TAGAACTCACAAATTTTCCAGGG + Intergenic
1032865888 7:135924038-135924060 ATGTACCCAAATATTGACCATGG - Intergenic
1038193305 8:25343732-25343754 TAGTAGCTGGAAATTGACCATGG + Intronic
1042760478 8:72266931-72266953 AAGTACCTACAAAGTGACAATGG - Intergenic
1043168919 8:76939482-76939504 TAATACCCACAAGTAGCCCAAGG - Intergenic
1047064931 8:121271164-121271186 GAGTACCCACAAATAGAGCAGGG - Intergenic
1055687208 9:78788812-78788834 CACTTCCCACAAATTGACTAGGG - Intergenic
1056702405 9:88921797-88921819 TTGAACCCCCAAAGTGACCACGG + Intergenic
1195175725 X:102313606-102313628 CAATACCCACAGGTTGACCAGGG - Intronic
1195183139 X:102373487-102373509 CAATACCCACAGGTTGACCAGGG + Intronic
1197610115 X:128628694-128628716 TAGTACTCACAAAAAGAGCATGG + Intergenic