ID: 950795884

View in Genome Browser
Species Human (GRCh38)
Location 3:15510583-15510605
Sequence CTGTAATCCCAGCTACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22871
Summary {0: 20, 1: 489, 2: 3753, 3: 7843, 4: 10766}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950795876_950795884 27 Left 950795876 3:15510533-15510555 CCCTGTCTCTACAAAAAATACAA 0: 3161
1: 73363
2: 174048
3: 201134
4: 149065
Right 950795884 3:15510583-15510605 CTGTAATCCCAGCTACTGGAAGG 0: 20
1: 489
2: 3753
3: 7843
4: 10766
950795877_950795884 26 Left 950795877 3:15510534-15510556 CCTGTCTCTACAAAAAATACAAA 0: 4906
1: 182049
2: 224254
3: 133293
4: 96629
Right 950795884 3:15510583-15510605 CTGTAATCCCAGCTACTGGAAGG 0: 20
1: 489
2: 3753
3: 7843
4: 10766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950795884 Original CRISPR CTGTAATCCCAGCTACTGGA AGG Intronic
Too many off-targets to display for this crispr