ID: 950796859

View in Genome Browser
Species Human (GRCh38)
Location 3:15517168-15517190
Sequence GAGGAGAGTTTCCAGAGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 419}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950796855_950796859 10 Left 950796855 3:15517135-15517157 CCTGTCTCGAAAAAACAAACAAA 0: 3
1: 239
2: 1359
3: 20998
4: 43409
Right 950796859 3:15517168-15517190 GAGGAGAGTTTCCAGAGGATAGG 0: 1
1: 0
2: 1
3: 43
4: 419
950796853_950796859 30 Left 950796853 3:15517115-15517137 CCTGGGCAACAGAGCGAGACCCT 0: 867
1: 15707
2: 67384
3: 165843
4: 236732
Right 950796859 3:15517168-15517190 GAGGAGAGTTTCCAGAGGATAGG 0: 1
1: 0
2: 1
3: 43
4: 419
950796854_950796859 11 Left 950796854 3:15517134-15517156 CCCTGTCTCGAAAAAACAAACAA 0: 4
1: 241
2: 1522
3: 21838
4: 40126
Right 950796859 3:15517168-15517190 GAGGAGAGTTTCCAGAGGATAGG 0: 1
1: 0
2: 1
3: 43
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950796859 Original CRISPR GAGGAGAGTTTCCAGAGGAT AGG Intronic
900863631 1:5251558-5251580 AAGGATAGTTTCCAGAGGCTGGG - Intergenic
902744787 1:18466542-18466564 GCTGAGAGATTCCTGAGGATGGG - Intergenic
904462347 1:30687577-30687599 GAGGAGAGTCTGCAGAGGGTGGG - Intergenic
904707028 1:32399159-32399181 GAGGAGAGTCACCAAAGGTTTGG + Intergenic
904916521 1:33974369-33974391 GAGGAGCATTTCCAGAAGAAAGG - Intronic
905861363 1:41354110-41354132 GATGAGAGTTTACAAAGGGTAGG + Intergenic
905999939 1:42415979-42416001 AAGTAGAGTTTCAAGGGGATTGG - Exonic
907132875 1:52112294-52112316 GAGGAGGCATTCCAAAGGATGGG - Intergenic
907790492 1:57658942-57658964 AATGAGAATTTCCAGAGAATGGG - Intronic
907878510 1:58519485-58519507 GAGGTGAGTTTGCATAGGCTGGG - Intronic
910547837 1:88439271-88439293 GAGGATGGTTACCAGAGGCTGGG + Intergenic
910642090 1:89474006-89474028 GAACAGAGCTTCCAGAGGAAGGG + Intergenic
911596879 1:99808015-99808037 AAGGACAGTTACCAGAGGTTGGG + Intergenic
912213051 1:107576133-107576155 GGGGAGAGTTTGCAGAGGGATGG - Intronic
912312990 1:108641742-108641764 AAGGATAGTTACCAGAGGCTGGG + Intronic
912702530 1:111888871-111888893 GAGGAGAGGCTGCAGAGGAGAGG + Intronic
912952372 1:114128707-114128729 AGGAAGTGTTTCCAGAGGATGGG - Intronic
913049188 1:115101185-115101207 GAGGATAGTTACCAGAGGCTGGG + Intergenic
913237730 1:116799326-116799348 GAGGGGAGATTCCTGGGGATTGG + Intergenic
913316254 1:117555551-117555573 GAGAGGAGTTTTCAGTGGATAGG + Intergenic
913447631 1:118966604-118966626 GAGGAGAGTATACTGAGGAAAGG + Intronic
914676860 1:149912711-149912733 GATGGGAGTTTCCAGGGGACAGG - Intronic
916261236 1:162844417-162844439 GCAGAGAGTTTCCAGAGGGAAGG - Intronic
916985301 1:170184823-170184845 AATGAGAGTTACCAGAGGCTGGG - Intergenic
917393948 1:174571248-174571270 AAGGATAGTTACCAGAGGCTGGG + Intronic
918663123 1:187114230-187114252 GAGGATGGTTACCAGAGGCTGGG + Intergenic
918938084 1:190950865-190950887 GAGGACAGTGTTCAGGGGATAGG + Intergenic
919595636 1:199558121-199558143 AAGGATGGTTTCCAGAGGCTGGG + Intergenic
920294777 1:204949235-204949257 GAAGAGAGATCCCAGAGGAGGGG - Intronic
921053511 1:211527336-211527358 GAGAAGAGGTTCCAGCGGAGGGG - Intergenic
921096930 1:211894828-211894850 GAGGAAATTTCCCAGAGGACAGG + Intergenic
921148737 1:212383354-212383376 GAGGAGGGCATCCAGAGAATAGG + Intronic
923824274 1:237482364-237482386 AAGGATAGTTACCAGAGGCTGGG - Intronic
923886132 1:238158532-238158554 GAGGGGGGTTACCAGAGGCTGGG - Intergenic
924452716 1:244192739-244192761 GAAGAGTGATTCCAGAAGATTGG + Intergenic
924461586 1:244264540-244264562 GTGGAGAGTTTCTAAAGAATCGG - Intergenic
924875224 1:248096030-248096052 GCAGAGAGTTTCCTGATGATAGG - Intronic
1063613479 10:7582818-7582840 AAGGATGGTTTCCAGAGGCTGGG + Intronic
1063700526 10:8380372-8380394 GAGGAGAACTCCCAGAGGAAAGG - Intergenic
1064404068 10:15045577-15045599 GAAGAAAGTTTACAGAGGGTGGG - Intronic
1064473547 10:15661992-15662014 GAGGACAGATTCTAGAGGATTGG + Intronic
1064521097 10:16202114-16202136 AAGGATAGTTACCAGAGGTTTGG - Intergenic
1064696285 10:17968949-17968971 AAGGATGGTTTCCAGAGGTTGGG - Intronic
1064899463 10:20277852-20277874 AAGGATAGTTACCAGAGGCTAGG - Intronic
1066128918 10:32371258-32371280 ATGGAGAGTTTCCAGTGGATTGG + Intronic
1066130858 10:32392310-32392332 AAGGATAGTTACCAGAGGCTGGG - Intergenic
1066526730 10:36288258-36288280 AAGGATGGTTACCAGAGGATGGG - Intergenic
1068959462 10:62852039-62852061 GAAGACAGTGGCCAGAGGATGGG + Intronic
1070555420 10:77523775-77523797 AAAGAGAGTTACCAGAGGCTGGG + Intronic
1070691354 10:78529146-78529168 GGTGAGAGTTTCCAAAGCATGGG + Intergenic
1071113375 10:82189124-82189146 AAGGAGAGTTACCAGAGGCTGGG - Intronic
1071270198 10:84000036-84000058 GGGGAGTGTTTGCAGAGCATGGG - Intergenic
1072167242 10:92825886-92825908 AAGAAGAGTATCCAGAGGAGGGG - Intergenic
1072283011 10:93886861-93886883 GAGGATGGTTACCAGAGGCTGGG + Intergenic
1072398775 10:95074358-95074380 CAGTAGAGTTACCAGAGGATGGG + Intergenic
1072423381 10:95308629-95308651 GAGGAGAAGTCCCAGAGGAGGGG - Intergenic
1072547494 10:96450790-96450812 GGGGAGAGTTTTCAGGGTATGGG + Intronic
1073537448 10:104290723-104290745 AAGGATAGTTTGCAGAGGCTAGG + Intronic
1073877506 10:107942052-107942074 AATGAGAATTTCCTGAGGATGGG - Intergenic
1074633548 10:115287875-115287897 GAGGAGAGGTACTAGAGGCTGGG - Intronic
1074851310 10:117441711-117441733 GAGCTGAATTTCCAGAGGAGAGG - Intergenic
1076705687 10:132300313-132300335 GAGATGGGTTTCCACAGGATTGG + Intronic
1077251679 11:1563528-1563550 CAACTGAGTTTCCAGAGGATGGG + Intronic
1077413466 11:2414019-2414041 GAGGAGAGCTGCCAGGGGGTGGG - Intronic
1077644370 11:3910361-3910383 GAGCAGAGATGCCAGAGGACTGG + Intronic
1078750704 11:14159865-14159887 AAGGATAATTTCCAGAGGCTGGG + Intronic
1079328754 11:19516769-19516791 GACCTGAGTTTCCAGAGGCTGGG + Intronic
1079404421 11:20132179-20132201 GGGGAGAGATTCCGCAGGATCGG - Intergenic
1079625367 11:22610782-22610804 AAGGATAGTTACCAGAGGCTGGG - Intergenic
1079728764 11:23913758-23913780 AAGGATGGTTTCCAGAGGCTGGG - Intergenic
1080775966 11:35387094-35387116 GAGGGGAGGTGCCAGAAGATGGG - Intronic
1080871647 11:36241807-36241829 TAGGAGAGTTGCCAGTTGATGGG + Intergenic
1081219098 11:40438088-40438110 CAGGAGAGTTGCCAGAGGTAAGG - Intronic
1082117368 11:48341864-48341886 GTGGAGAGTTTCCAGAACCTAGG + Intergenic
1082256307 11:50037259-50037281 GTGGAGAGTTTCCAGAAACTAGG - Intergenic
1082716902 11:56625290-56625312 GAGGAGAGTGTCAAGAGAATTGG + Intergenic
1082843374 11:57707701-57707723 GAGGAGAGTTGGCAGAGCAGGGG - Intronic
1084452514 11:69248165-69248187 GAAGTGAGGTTCCAGAGGAGTGG - Intergenic
1084929691 11:72544881-72544903 GAGGAGAGTTAACATAGGCTTGG + Intergenic
1086340035 11:85839419-85839441 AAGGATAGTTACCAGAGGATGGG + Intergenic
1086507595 11:87522124-87522146 GAGGAGACTATCCAGAGAGTAGG + Intergenic
1088018770 11:105093051-105093073 GAGGAAATTTTCCACAAGATAGG - Intronic
1088111291 11:106265229-106265251 AAGGATGGTTACCAGAGGATGGG - Intergenic
1088375436 11:109135622-109135644 AAGGATGGTTACCAGAGGATGGG - Intergenic
1089572169 11:119418172-119418194 GAGGACAGATTCCAGAGGCTTGG + Exonic
1089742368 11:120593390-120593412 CAGCAGAGTGTCCACAGGATTGG - Intronic
1090951519 11:131477494-131477516 GAGGAGAGAGTACAGAGGAGAGG + Intronic
1091664463 12:2409364-2409386 GAAGATACTTCCCAGAGGATGGG - Intronic
1091962822 12:4712918-4712940 GAGGAGACTTTGCAGAAGCTTGG + Intronic
1093608545 12:21125206-21125228 GAGAAGGCTTTCCAAAGGATGGG - Intronic
1093992081 12:25601279-25601301 AAGGACAGTTACCAGAGGCTGGG + Intronic
1093993189 12:25613027-25613049 GAGGACAGATTCCAGAATATAGG + Intronic
1094096300 12:26708579-26708601 AAGGATAGTTACCAGAGGCTAGG + Intronic
1094259057 12:28470914-28470936 AAGGATGGTTACCAGAGGATGGG + Intronic
1095458758 12:42418815-42418837 AAAGAGAGTTTCCTGAGGATAGG + Intronic
1096230165 12:49892289-49892311 GAGGAGAGGTACCAGTGGAAAGG - Intronic
1096750161 12:53753497-53753519 TAGGAGGGTTCCTAGAGGATAGG + Intergenic
1097107239 12:56633046-56633068 AAGGAGAGTCTCCAGGGAATAGG + Intronic
1097897970 12:64844680-64844702 AAGGATGGTTTCCAGAGGCTGGG - Intronic
1098012731 12:66071634-66071656 GAGGAAAGGGTCCAGAGGAATGG - Intergenic
1098207338 12:68125746-68125768 GAGGATAGTTGCCAGAGGCTGGG - Intergenic
1099346008 12:81500470-81500492 TTGGAGAGTTTCCAGAGCAAAGG + Intronic
1099997583 12:89795758-89795780 GAAGAGAGTTTACAAAGGTTTGG - Intergenic
1100430690 12:94529430-94529452 GAGGAGAGGTGTCAGAGGTTGGG + Intergenic
1100923344 12:99515336-99515358 GATGATGGTTTCCAGAGGCTGGG - Intronic
1100925136 12:99536920-99536942 GAGGATGGTTACCAGAGGCTGGG - Intronic
1102013045 12:109630820-109630842 GAGGGGAATATACAGAGGATAGG + Intergenic
1103666400 12:122570135-122570157 GAGGATGGTTACCAGAGGCTTGG + Intronic
1103950432 12:124548100-124548122 GAGGAGAGGTCCCATAGGAGGGG - Intronic
1104440479 12:128789649-128789671 AGGGAGTGTTTCCAGAGGATGGG - Intergenic
1105624223 13:22097798-22097820 GAGAACAGTTTCCAGGGGATTGG - Intergenic
1106557046 13:30818735-30818757 GAGGAGAGATTTCTGAGGAGAGG - Intergenic
1107675082 13:42787458-42787480 GAGGAGAGACAGCAGAGGATGGG - Intronic
1107707962 13:43125688-43125710 AAGGACAGTTACCAGAGGCTGGG + Intergenic
1107821680 13:44291566-44291588 GAGGTGAGTTTCCAGGGGGAAGG + Intergenic
1108372053 13:49779924-49779946 GAGGAGAGTTTCCTGAAGGAGGG - Intronic
1108596027 13:51950318-51950340 GGGGAAAGTTTCCAGTGGATGGG - Exonic
1109377533 13:61516848-61516870 GGGGAGAGTTTCATGAGGAAAGG + Intergenic
1110946902 13:81433152-81433174 GAGCAGGGTTTTCAGAGGATTGG + Intergenic
1111971309 13:94919710-94919732 GAGGAGTGTTTCCAGGGAGTAGG - Intergenic
1112514900 13:100044862-100044884 GAGGAGAGTTACTAGTAGATTGG + Intergenic
1113059367 13:106305341-106305363 GAGGAGAGTTAGTAGTGGATGGG + Intergenic
1113685071 13:112277449-112277471 AAGGAGTGTTTCCTCAGGATGGG + Intergenic
1113991356 14:16030169-16030191 GAGGAGTGCTTCCAGCGGAGCGG + Intergenic
1114178273 14:20343258-20343280 GAGGTGAGTTCCCAGAGAACGGG - Intergenic
1114346243 14:21798320-21798342 AAGGATGGTTTCCAGAGGCTGGG - Intergenic
1114862092 14:26536188-26536210 GAGGATGGTTACCAGAGGCTCGG + Intronic
1115758730 14:36556647-36556669 GAGGAGAGTTGGAAGAGGAGAGG + Intergenic
1116491974 14:45515432-45515454 GAGGACAGCTACCAGAGGCTGGG + Intergenic
1117288435 14:54309604-54309626 GCGGAGTCTGTCCAGAGGATTGG - Intergenic
1117765410 14:59076799-59076821 AAGGATGGTTTCCAGAGGCTGGG - Intergenic
1118155153 14:63233049-63233071 GAGGAGAGTAGCCAAAGGATAGG + Intronic
1118441260 14:65813810-65813832 GAGGAGGGCTTCCAGATTATAGG + Intergenic
1118453316 14:65923753-65923775 TAGGGGAGATTACAGAGGATGGG - Intergenic
1119627137 14:76187877-76187899 AAGGAGGGTTACCAGAGGCTGGG - Intronic
1120668966 14:87342073-87342095 AAGGATAGTTACCAGAGGCTAGG + Intergenic
1120736617 14:88060175-88060197 GAGGATGGTTACCAGAGGCTGGG + Intergenic
1120822285 14:88923080-88923102 GAGGATGGTTACCAGAGGCTGGG - Intergenic
1121525276 14:94615177-94615199 GAGGAGAGTGCCCACAGCATGGG + Intronic
1202842103 14_GL000009v2_random:131421-131443 ACTGAGAGTTTCCAGAGGCTGGG + Intergenic
1202911492 14_GL000194v1_random:121654-121676 ACTGAGAGTTTCCAGAGGCTGGG + Intergenic
1123907567 15:24935696-24935718 CAGGAGAGTTTTCAGAGCAGTGG + Intronic
1126202592 15:46004217-46004239 AAGGATAGTTACCAGAGGCTGGG - Intergenic
1126683291 15:51225001-51225023 GGGGAGACTTTTCAGAGGAATGG - Intronic
1126904890 15:53353957-53353979 AAGGATGGTTACCAGAGGATGGG - Intergenic
1127298905 15:57633685-57633707 GAGGAGAAAGACCAGAGGATCGG + Exonic
1127649820 15:60996025-60996047 GAGGAAAGTTTCTAGAGGGATGG + Intronic
1127680195 15:61287539-61287561 AAGGATAGTTACCAGAGGCTGGG - Intergenic
1128041899 15:64582406-64582428 GAGCAGAGATTCCAGAGGAAGGG - Intronic
1129744229 15:78007140-78007162 TAGGAGAGTACCCAGAGGATGGG + Intronic
1129848061 15:78777087-78777109 CAGGAGTGTTTCCAGAGGAGGGG - Intronic
1130553379 15:84905864-84905886 GAGTAGTCTTTCCAGAGGCTGGG + Intronic
1131279565 15:91009642-91009664 GAGGAGAGGTTCCTGAGAATGGG - Intronic
1131314659 15:91323949-91323971 AAGGATAGTTACCAGAGGCTGGG - Intergenic
1132389606 15:101428692-101428714 GAGAAGAGTCCACAGAGGATGGG + Intronic
1134414551 16:14032231-14032253 GAGGAGAGGATCCAGAGGTTGGG + Intergenic
1135107755 16:19665341-19665363 AAGGATAGTTACCAGAGGCTGGG - Intronic
1135929699 16:26726100-26726122 GAGGAGAGAATTCAGAGGAAAGG - Intergenic
1136271234 16:29149550-29149572 AAGGAGGGTTACCAGAGGCTGGG - Intergenic
1137518766 16:49173726-49173748 GGAGAGAGTATCCAGAGGAGGGG + Intergenic
1138436266 16:57001911-57001933 AAGGATGGTTACCAGAGGATGGG - Intronic
1138952756 16:61933283-61933305 GAGGAGAGTGACAAGAGGAGAGG + Intronic
1139060417 16:63243853-63243875 TAGGAGTGTTTCCAGAGGAGGGG - Intergenic
1141038470 16:80650946-80650968 GAGGACAGTTACCAGGGGCTGGG + Intronic
1143474449 17:7194693-7194715 GAGCACAGTTTCCAGAGGCAGGG + Intronic
1146541208 17:33696997-33697019 GAGGACAGTATCAAGAGGAATGG - Intronic
1147488904 17:40845394-40845416 GAGGAGAATTTTGAGAAGATGGG + Intergenic
1148770463 17:50063254-50063276 GAGCAGAGTTCCCAGTGGGTGGG - Intronic
1149042017 17:52201524-52201546 TAAGAGTGTTTCCAGGGGATGGG + Intergenic
1149240961 17:54648564-54648586 AAGGACAGTTACCAGAGGCTGGG + Intergenic
1149376927 17:56053309-56053331 AAGGATAGTTACCAGAGGCTGGG - Intergenic
1149906677 17:60532987-60533009 AAGGATAGTTACCAGAGGCTGGG + Intergenic
1150547663 17:66177728-66177750 AAGGATGGTTTCCAGAGGGTGGG - Intronic
1150967340 17:69986977-69986999 GAGGATGGTTACCAGAGGCTGGG + Intergenic
1151128868 17:71875205-71875227 AAGGACAGTTACCAGAGGCTGGG + Intergenic
1151532195 17:74713711-74713733 GAGGAGAGATTCCAGACCAAAGG + Intronic
1152423189 17:80205007-80205029 GAGGAGAGGATCCTGAGGGTGGG - Intronic
1153511615 18:5860794-5860816 AAGGATAGTTACCAGAGGCTGGG + Intergenic
1157886876 18:51377262-51377284 AAGGATAGTTACCAGAGGCTGGG + Intergenic
1158161808 18:54493401-54493423 TAGGACAATTTCCAGAGTATAGG - Intergenic
1161363808 19:3867526-3867548 GAGGAGAGATGGCAGGGGATGGG - Intronic
1164147069 19:22518598-22518620 GAGGAGCGTTTGCACAGGCTAGG + Intronic
1164159567 19:22617730-22617752 GAGGAGCGTTTGCACAGGCTAGG - Intergenic
1164324091 19:24177726-24177748 GAGGAGAGTGGCCAGGGCATGGG + Intergenic
1164706077 19:30321180-30321202 GAGAAGAGTTTGCAGAGAAAAGG - Intronic
1164739922 19:30568274-30568296 GAGGAAAGTACCCAGAGGTTGGG + Intronic
1166910433 19:46151087-46151109 AAGGGCAGTTACCAGAGGATTGG - Intronic
1167406182 19:49310219-49310241 GAGGGGATTTGACAGAGGATTGG + Intronic
1167986987 19:53327023-53327045 GAGGAGGGTTTCCTAGGGATGGG - Intergenic
925313985 2:2907432-2907454 GCGGAGAGTTCCCAGGGCATTGG - Intergenic
925384979 2:3455512-3455534 GAGGATGGTTACCAGAGGCTGGG - Intronic
926833501 2:16990902-16990924 AAGGACAGTTACCAGAGGCTGGG - Intergenic
927426002 2:22981938-22981960 GTGGAGAGTTGCCAGAAGAGAGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
928271610 2:29860050-29860072 GGGGAGAATTTCAAGAGGGTAGG + Intronic
928494414 2:31817480-31817502 TAGGATAGTTACCAGAGGCTTGG - Intergenic
928867798 2:35938326-35938348 GACTAGAGTTTCCAGAGTTTAGG - Intergenic
929442167 2:41972938-41972960 GAGGGGAGTTGCAAGAGGATAGG - Intergenic
930527871 2:52553472-52553494 TAGGATAGTTCCCAGAGGCTAGG + Intergenic
931486038 2:62693028-62693050 GAGGATGGTTACCAGAGGCTGGG - Intronic
931572892 2:63688475-63688497 AAGGACAGTTACCAGAGGCTAGG + Intronic
931806011 2:65805134-65805156 AAGGATGGTTACCAGAGGATGGG + Intergenic
931854631 2:66288995-66289017 GAGGATGGTTACCAGAGGCTGGG - Intergenic
932184799 2:69685047-69685069 TAGGAGAGATTCCAGAAGACTGG + Intronic
932187146 2:69707889-69707911 GAGGATGGTTACCAGAGGCTGGG - Intronic
932211110 2:69931340-69931362 TAGGAGGGTTACCAGAGGCTGGG - Intronic
932886198 2:75551439-75551461 GAGGAGAGTTTCCAGGAGAGGGG - Intronic
933317621 2:80734688-80734710 AAGGATTGTTACCAGAGGATGGG + Intergenic
934015715 2:87879478-87879500 GAGGACATTTACCAGAGGCTGGG - Intergenic
934557662 2:95296034-95296056 GAGGACTGTTTCCAGAGGGGAGG - Intergenic
934870883 2:97864206-97864228 GAGGATGGTTACCAGAGGCTGGG + Intronic
935536265 2:104298075-104298097 GAGGAAAGTTTGGAGAGGTTAGG - Intergenic
935877693 2:107529300-107529322 GAGGAGATTTCCAAGAGGAAAGG + Intergenic
937071650 2:119067934-119067956 GAGGGCAGTGTCCAGGGGATAGG + Intergenic
937903126 2:127037874-127037896 GAGGAGAGTTGCTACAGGAGAGG - Intergenic
939245211 2:139614471-139614493 AAGAAGAATTTTCAGAGGATAGG - Intergenic
939737989 2:145873278-145873300 GTGCATAGTTTCCAGAAGATAGG + Intergenic
940416858 2:153433027-153433049 GAGGAGAGTCTCCAAATGCTTGG - Intergenic
940555439 2:155221118-155221140 AAGGAGGGTTACCAGAGGCTGGG + Intergenic
941023292 2:160432969-160432991 GATGAGAATTCCCTGAGGATTGG - Intronic
941341309 2:164308628-164308650 AAGGAGGGTTACCAGAGGCTGGG + Intergenic
941578140 2:167261648-167261670 GAAGATAGTTACCAGAGGCTGGG - Intergenic
941851280 2:170184349-170184371 AAGGATAGTTACCAGAGGCTGGG - Intronic
942391303 2:175496120-175496142 AAGGATAGTTACCAGAGAATGGG - Intergenic
944268837 2:197759227-197759249 GAGAAGGGTTTGCAGAGGCTGGG - Intronic
944814681 2:203363543-203363565 AAGGATGGTTACCAGAGGATGGG - Intronic
947707033 2:232284692-232284714 CAGGAGAGATTCCAGGTGATGGG - Intronic
947911306 2:233802679-233802701 GAGGGTAGTCTACAGAGGATGGG - Intronic
948046688 2:234951400-234951422 GAGGAGAGTTTCCTGCGAAGCGG - Intergenic
948295646 2:236858329-236858351 GAGGAAAGGTTGCAGTGGATAGG - Intergenic
948471984 2:238188298-238188320 GACTAGGGTTTCCAGAGGGTTGG - Intronic
1168757596 20:327225-327247 GAGGAGAGATTCCGGAGCAAAGG - Exonic
1169577000 20:6974545-6974567 TGGAAAAGTTTCCAGAGGATAGG + Intergenic
1169645089 20:7801496-7801518 GTGGTGACTTTCCAGAAGATCGG - Intergenic
1169742173 20:8906827-8906849 GAGGTTAAGTTCCAGAGGATGGG + Intronic
1170306226 20:14941282-14941304 GAGCAGAGTTTCCTGGGGAGGGG + Intronic
1170384770 20:15804617-15804639 GCTGAGAGTTTACAGTGGATAGG + Intronic
1171770519 20:29319518-29319540 GAGGAGTGGTTCCAGCGGAGAGG - Intergenic
1171906000 20:30900001-30900023 GAGGAGTGTTTCCAGCGGAGCGG + Intergenic
1173297384 20:41771798-41771820 GACCAGATTTTTCAGAGGATGGG + Intergenic
1174063816 20:47850594-47850616 GAGGCCAGTTACCAGAGGCTGGG + Intergenic
1174768465 20:53275506-53275528 GAGGTGATTTTCAAGAGGAAAGG + Intronic
1176630851 21:9136323-9136345 ACTGAGAGTTTCCAGAGGCTGGG + Intergenic
1176642434 21:9318501-9318523 ACTGAGAGTTTCCAGAGGCTGGG - Intergenic
1177584855 21:23077986-23078008 GAGGATGGTTACCAGAGGCTGGG + Intergenic
1180315912 22:11277355-11277377 GAGGAGTGCTTCCAGCGGAGCGG - Intergenic
1180339424 22:11606121-11606143 GAGGAGTGGTTCCAGCGGAGCGG + Intergenic
1180351448 22:11807855-11807877 ACTGAGAGTTTCCAGAGGCTGGG - Intergenic
1180375735 22:12091283-12091305 ACTGAGAGTTTCCAGAGGTTGGG - Intergenic
1180386755 22:12184222-12184244 ACTGAGAGTTTCCAGAGGCTGGG + Intergenic
1181096641 22:20509523-20509545 GAAGACAGATTCCAGAGGAGGGG + Intronic
1181576828 22:23800619-23800641 GGGGAGACTTCCCAGAGGAGTGG - Intronic
1183008783 22:34927567-34927589 GAGGAGGGTTACCAGAGGCTGGG + Intergenic
1183725193 22:39584660-39584682 GAAGAGAGTTTCTAGAGCAGGGG + Intronic
1183732881 22:39628371-39628393 GAGGAGGCTTCCCAGAGGAGGGG + Intronic
1184401805 22:44278830-44278852 GAGGAGGGTTCCTAGAGGCTGGG + Intronic
1184504233 22:44891390-44891412 GAAGAGAGCCTCCAGATGATGGG - Intronic
1185028509 22:48429320-48429342 CAGGAGAGATTCCATACGATGGG + Intergenic
950796859 3:15517168-15517190 GAGGAGAGTTTCCAGAGGATAGG + Intronic
950939417 3:16878401-16878423 GAGGACAGTTTCCATAGAAGGGG + Intronic
951246923 3:20351830-20351852 GAGGATAGTTACCAGAGGCTGGG - Intergenic
953280808 3:41554528-41554550 GATGATAGTTACCAGAGGCTGGG + Intronic
953353892 3:42237958-42237980 AAGGATAGTTACCAGAGGCTGGG + Intergenic
953376071 3:42429594-42429616 GAGGAGAGTGAACAGAGGATTGG - Intergenic
953378366 3:42447632-42447654 TAGGAGATTTTCCAGAGCAGGGG - Intergenic
954281727 3:49584797-49584819 AAGGATAGTTACCAGAGGCTGGG - Intronic
954426688 3:50447132-50447154 GAGGAGAGCTTCCGGGGGAGGGG + Intronic
954995939 3:54881801-54881823 GTGGTGAGTTTCCAGAAGCTGGG + Intronic
955001300 3:54930194-54930216 GAGAGCAGTTGCCAGAGGATGGG - Intronic
958879859 3:99657738-99657760 GAGTAAAGTCTCCAGAGGGTAGG - Intronic
959002688 3:100982748-100982770 TAGGGGAGTTTGGAGAGGATGGG + Intronic
959709217 3:109368125-109368147 TAGAAGAGTTTGAAGAGGATTGG + Intergenic
959971581 3:112416013-112416035 AAGGATAGTTACCAGAGGCTGGG - Intergenic
960870682 3:122246818-122246840 CAGGAGAGTTGCAAGTGGATGGG + Intronic
962974140 3:140431542-140431564 GAGGAGAGATTCAAAAAGATAGG - Intronic
963402617 3:144820113-144820135 CAGGAGAGTCTCCAGAGACTGGG - Intergenic
963544093 3:146632910-146632932 GACGAGATTTACCAGAGGCTGGG - Intergenic
965984036 3:174729509-174729531 AGAGACAGTTTCCAGAGGATGGG + Intronic
1202744451 3_GL000221v1_random:86517-86539 ACTGAGAGTTTCCAGAGGCTGGG + Intergenic
970152089 4:13100843-13100865 GTGGATAGTTTCCAGAGGAGAGG + Intergenic
970404568 4:15749999-15750021 AAGGATAGTTACCAGAGGCTGGG - Intergenic
972395773 4:38658477-38658499 GAGGTGAGTTGTCAGAGAATGGG - Intergenic
972706997 4:41554547-41554569 AAGCAGTGTGTCCAGAGGATAGG - Intronic
973762167 4:54127668-54127690 AAGGATAGTTACCAGAGGCTGGG - Intronic
974292779 4:59955160-59955182 AATGATAGTTTCCAGAGGCTGGG + Intergenic
974343691 4:60649619-60649641 GAAGGGAGTTTCTAAAGGATTGG - Intergenic
975345374 4:73287066-73287088 GAGCAGAGTTTCCAGAGATAAGG - Intergenic
975841602 4:78480250-78480272 AAGGATGGTTACCAGAGGATGGG - Intronic
976128943 4:81863754-81863776 AAGGATAGTTACCAGAGGCTGGG + Intronic
976133448 4:81909368-81909390 GAGGAGAGTTTGCGGTGGAGTGG + Intronic
976619121 4:87110527-87110549 AAGGATGGTTACCAGAGGATTGG - Intronic
976740352 4:88350039-88350061 AAAGGCAGTTTCCAGAGGATAGG - Intergenic
977002321 4:91519328-91519350 GACTGGAGTTTCCAGAGGGTGGG - Intronic
977336672 4:95708331-95708353 GATGAGAATTTCCAGAGAAAGGG + Intergenic
978097564 4:104796894-104796916 AAGGATAGTTACCAGAGGCTAGG - Intergenic
978918964 4:114158818-114158840 AAGGATAGTTACCAGAGGCTTGG + Intergenic
979812099 4:125049148-125049170 AAGGATGGTTACCAGAGGATAGG + Intergenic
980089760 4:128430518-128430540 CAGGATAGTTACCAGAGGCTGGG - Intergenic
980220292 4:129904107-129904129 GAGGAGGGTTTCCAGAATATGGG + Intergenic
981519816 4:145649748-145649770 GGAGAGAGTTTCCAGAGTTTTGG + Intronic
981691338 4:147512954-147512976 GAAGAGAGAATCCAGAGGAAGGG - Intronic
984049290 4:174843813-174843835 AAGGAGAGTTTCCAGATTCTTGG + Intronic
984462078 4:180051011-180051033 CAGGAGAGTTGCCTGAGGGTGGG - Intergenic
984514606 4:180722456-180722478 GATGATAGTTACCAGAGGCTAGG + Intergenic
1202757333 4_GL000008v2_random:76724-76746 ACTGAGAGTTTCCAGAGGTTGGG - Intergenic
985693186 5:1324954-1324976 GAGGAGAGGACCCAGAGGACGGG + Intronic
986772991 5:10990207-10990229 GAAGAGAGGTTCCAGGGGAGAGG + Intronic
987481412 5:18463427-18463449 GAGGATGGTTACCAGAGGCTAGG + Intergenic
987999839 5:25333932-25333954 GATGATAGTTACCAGAGGCTGGG + Intergenic
988152323 5:27400206-27400228 GAGAGTAGTTTCCAGAGGCTGGG + Intergenic
988554993 5:32228932-32228954 AAGGAGAGACTCCAGAGGAATGG + Exonic
989764396 5:45063211-45063233 GAGTAGAATTCCTAGAGGATAGG + Intergenic
990353897 5:54946194-54946216 GAGGAGAGGTGCCAGAGGTTGGG + Intergenic
990774586 5:59291406-59291428 GAAGACAGTTTCCGGAGGTTAGG + Intronic
990923212 5:60991464-60991486 AAGGATAGTTACCAGAGGCTGGG - Intronic
991011588 5:61888348-61888370 GAGAAGAGTTTCCAGAGCTGGGG - Intergenic
991952160 5:71956753-71956775 GAGGGGAGTATGCAGAGGCTTGG + Intergenic
992349880 5:75917646-75917668 AAGGATAGTTACCAGAGGCTAGG + Intergenic
993021974 5:82603071-82603093 ATGGAGAGTTTCCGGAGGGTAGG - Intergenic
993052425 5:82940797-82940819 GAGTATAGTTTCCAGAGAAGGGG + Intergenic
993179368 5:84531394-84531416 AAGGATGGTTACCAGAGGATGGG + Intergenic
994492861 5:100470493-100470515 AATGATAGTTACCAGAGGATAGG + Intergenic
994877214 5:105439614-105439636 AAGGACAGTTACCAGAGGTTGGG + Intergenic
995615109 5:113953067-113953089 GAAGACATTTTCCAGAGAATAGG - Intergenic
996115929 5:119618442-119618464 GAGGATAATTACCAGAGGCTGGG - Intronic
998139194 5:139690376-139690398 GAGGAGGGGTCCCAAAGGATGGG - Intergenic
998670306 5:144346016-144346038 AAGAATAGTTTCCAGAGGCTAGG - Intronic
999379674 5:151111422-151111444 GAGGAAGGTTTCCAGAGTATAGG - Intronic
999480775 5:151946390-151946412 GAGAAGAATTTAAAGAGGATTGG + Intergenic
1000913650 5:167053033-167053055 GAGGAGCCTTTTCTGAGGATTGG - Intergenic
1001768525 5:174274345-174274367 GAGGAGTGGTTACAGAGGATTGG - Intergenic
1002108029 5:176889790-176889812 GAGGAGGGAATCCAGGGGATGGG + Intronic
1005049082 6:21666893-21666915 GAGGAGGGTTTCAAAAGGGTGGG + Intergenic
1005490129 6:26340432-26340454 GATGAGACTTTCCAGAGAAGAGG + Intergenic
1007746713 6:44047679-44047701 GAGGATTCTTTCCAGAGGGTGGG - Intergenic
1008383923 6:50865558-50865580 GAGGAGAGTCACCAGAAGCTAGG + Intergenic
1009957857 6:70477631-70477653 GAGGACAGTATCAAGAGGAATGG + Intronic
1010539675 6:77075914-77075936 GAGCAGAGTTTCCAGAGCAGGGG - Intergenic
1011796600 6:90960631-90960653 GAGGAAAGCTACCTGAGGATAGG - Intergenic
1012342051 6:98139417-98139439 AAGGATGGTTTCCAGAGGCTGGG + Intergenic
1012559163 6:100557685-100557707 GAGGAAGATTGCCAGAGGATGGG + Intronic
1012617912 6:101300462-101300484 AAGAAGAGTTTCCAGAAGAATGG - Intergenic
1013799730 6:113929077-113929099 GAGGAGACTATCCACAGAATGGG - Intergenic
1014051007 6:116954302-116954324 AAGGAGGGTTACCAGAGGCTGGG - Intergenic
1014840327 6:126211937-126211959 AAGGATAGTTACCAGAGGCTGGG - Intergenic
1015103490 6:129508524-129508546 AAGGATAGTTACCAGAGGTTGGG - Intronic
1016065151 6:139674491-139674513 AAGGATAGTTACCAGAGGTTGGG + Intergenic
1017806515 6:157951325-157951347 AAGGATAGTTACCAGAGGCTGGG + Intergenic
1017916878 6:158838018-158838040 GAGGAGCTTTTCCAGAGGGAGGG + Intergenic
1018211449 6:161486494-161486516 GAGGTGAGTTAACAGAGGCTCGG + Intronic
1018381733 6:163264210-163264232 AAGGAGAGCTTCCAGAGGTCCGG - Intronic
1018506833 6:164480845-164480867 GAGGAAACTTTCCAGAGCATTGG + Intergenic
1018839854 6:167508983-167509005 GAGGAGAGTTGACAGGGGAAGGG - Intergenic
1019021741 6:168924399-168924421 CAGGACAGTGTCAAGAGGATGGG - Intergenic
1019021757 6:168924493-168924515 GAGGACAGTGTCAAGAGGATGGG - Intergenic
1020233752 7:6339844-6339866 GAGGAGAGTGTGCAGAGGCCGGG + Intronic
1020480099 7:8648323-8648345 AAGGATGGTTTCCAGAGGCTGGG - Intronic
1022348747 7:29545818-29545840 GAGGAAGATTGCCAGAGGATGGG + Intergenic
1022472097 7:30688380-30688402 TAGGTGAGTTTCCAGGGGCTGGG + Intronic
1022871483 7:34484719-34484741 AAGGATAGTTACCAGAGGCTGGG + Intergenic
1024368581 7:48552979-48553001 AAGGATAGTTACCAGAGGCTGGG - Intronic
1026329725 7:69341284-69341306 GAGAAGACTTTACAGAGGCTGGG + Intergenic
1026537747 7:71254116-71254138 GAGGAGAGCTTCCAGGTCATAGG + Intronic
1026542532 7:71292871-71292893 GATGCTAATTTCCAGAGGATGGG - Intronic
1026663490 7:72322641-72322663 AAGGATGGTTTCCAGAGGCTGGG + Intronic
1027688338 7:81307028-81307050 CAGGACAGTTGCCACAGGATTGG + Intergenic
1029448195 7:100626628-100626650 GAAGAGAGCATCCAGAGGACCGG + Intronic
1030346355 7:108437249-108437271 GAGGATGGTTACCAGAGGCTAGG + Intronic
1030752991 7:113254509-113254531 GAGGATAATTACCAGAGGCTGGG + Intergenic
1031746071 7:125499642-125499664 AAGGATAGTTACCAGAGGCTGGG - Intergenic
1032669217 7:134068123-134068145 GTCAAGAGTTTCAAGAGGATGGG - Intergenic
1032756285 7:134893664-134893686 GAGGAAGGTTTACAGAGGAAGGG - Intronic
1032968336 7:137129557-137129579 AAGGACAGTTTCCAGAGAAATGG + Intergenic
1033486782 7:141797905-141797927 GATGATAGTTACCAGAGGCTGGG - Intergenic
1033822692 7:145152997-145153019 GAGCAGAGTTTCCAATGGATAGG - Intergenic
1034019336 7:147625085-147625107 AAGGATGGTTTCCAGAGGCTGGG + Intronic
1034136828 7:148778702-148778724 TAGGAGAGTTCCCTGAGGACAGG - Intronic
1034940794 7:155228865-155228887 GAGGTGAGCTTCCAGAGGCTGGG + Intergenic
1034942095 7:155237305-155237327 GAGGGGAGTTTCTGGAGGATTGG - Intergenic
1037106229 8:15111574-15111596 GAGGAGACATTCCACAGGGTGGG - Intronic
1037501151 8:19486572-19486594 GAAGAGAGTTTCCAGATGGAAGG - Intronic
1038496466 8:28006913-28006935 GAGGATGGTTTCCAAAGGAGGGG - Intergenic
1038903815 8:31874769-31874791 AAGGACAGTTACCAGAGGCTGGG - Intronic
1038922762 8:32103194-32103216 AAGGATGGTTACCAGAGGATAGG - Intronic
1038947414 8:32376450-32376472 ATGGTGATTTTCCAGAGGATGGG + Intronic
1040417420 8:47207547-47207569 GGGGAGAGTTTCCAGAGATGAGG - Intergenic
1040628484 8:49179953-49179975 AAGGATAGTTTCCAGAGGCTGGG + Intergenic
1040671366 8:49694952-49694974 AATGACAGTTTCCAGAGGCTGGG - Intergenic
1040947403 8:52897785-52897807 GAGGAGAGAGTACAGAGAATTGG + Intergenic
1041465792 8:58156335-58156357 GAGCAGAATTTCCAGAGAACAGG - Intronic
1042484392 8:69334659-69334681 AAGGACGGTTGCCAGAGGATGGG + Intergenic
1043117172 8:76272399-76272421 TGGAAGAGTTTTCAGAGGATTGG - Intergenic
1044957538 8:97496942-97496964 TAGGACAGTTACCAGAGGCTAGG + Intergenic
1045554835 8:103206086-103206108 GAGGGCAGTTTCCAGAGTCTAGG + Intronic
1046870776 8:119203864-119203886 GGGGAGAGTTTTCAGAGCACAGG - Intronic
1047057797 8:121186246-121186268 AAGGGTAGTTTCCAGAGGCTGGG + Intergenic
1047072811 8:121366013-121366035 GAGGATAGTTACCAGAGGCTGGG + Intergenic
1047591101 8:126328554-126328576 CAGGAGAGTTTCCAGAGGGTGGG - Intergenic
1048102569 8:131369851-131369873 GATGAGAGTTTCTAGAGCTTGGG - Intergenic
1048109371 8:131451150-131451172 AAGGAGAGCTTACAGAGCATTGG - Intergenic
1048538168 8:135317003-135317025 GAGGAGAGTTTGAGGAGGAATGG - Intergenic
1049703036 8:144023660-144023682 GAGGGGAGTTTCAAGGGGAGAGG - Intronic
1049703270 8:144024470-144024492 GAGGGGAGTTTCAAGGGGAGAGG - Intronic
1050264242 9:3873171-3873193 TGGAATAGTTTCCAGAGGATTGG - Intronic
1050578129 9:7020988-7021010 GAGGATGGTTACCAGAGGCTAGG - Intronic
1050786692 9:9412544-9412566 GAGGAGAGTGGCCTGAGGCTGGG - Intronic
1053278806 9:36803121-36803143 CAGGAGTGTTTCCAGAGGGCAGG + Intergenic
1054854184 9:69880316-69880338 AAGGATGGTTACCAGAGGATGGG - Intronic
1054920197 9:70535985-70536007 GAGGAGACTGTCCAGAACATCGG - Exonic
1055395781 9:75873648-75873670 AAGGATAGTTACCAGAGGCTGGG + Intergenic
1055749553 9:79489569-79489591 GAAGAGAAATTCCAGAGGAGGGG + Intergenic
1056891104 9:90493684-90493706 GAGAAGGGTTTCCAGATCATAGG - Intergenic
1057291249 9:93808831-93808853 CAGCAGAGTTTATAGAGGATTGG + Intergenic
1058270193 9:102962796-102962818 GAGGAAAGCTGCCAGAGGCTTGG - Intergenic
1060762767 9:126270036-126270058 AAGGAGGGTTACCAGAGGCTGGG + Intergenic
1060803113 9:126557093-126557115 GCAGAGAGTGACCAGAGGATCGG + Intergenic
1060899884 9:127247940-127247962 GAGGAGGGCTACCAGAGGCTGGG - Intronic
1203688933 Un_GL000214v1:23779-23801 ACTGAGAGTTTCCAGAGGCTGGG - Intergenic
1203753681 Un_GL000218v1:104025-104047 ACTGAGAGTTTCCAGAGGCTGGG + Intergenic
1203444887 Un_GL000219v1:45436-45458 GAGGAGTGGTTCCAGCGGAGCGG + Intergenic
1203364208 Un_KI270442v1:243309-243331 GAGGAGTGCTTCCAGCGGAGCGG - Intergenic
1203713083 Un_KI270742v1:116466-116488 ACTGAGAGTTTCCAGAGGCTGGG + Intergenic
1203538123 Un_KI270743v1:61585-61607 ACTGAGAGTTTCCAGAGGTTGGG - Intergenic
1203647342 Un_KI270751v1:80274-80296 ACTGAGAGTTTCCAGAGGCTGGG + Intergenic
1186011901 X:5143630-5143652 GTGGACAGTTTCCAGGTGATAGG - Intergenic
1186138617 X:6547098-6547120 GAGCAAACTTTCCAGAAGATGGG + Intergenic
1186915741 X:14218284-14218306 AAGGACGGTTGCCAGAGGATGGG - Intergenic
1187131190 X:16504496-16504518 AAGGATAGTTACCAGAGGCTGGG - Intergenic
1187546673 X:20261113-20261135 AATGAGAGTTACTAGAGGATAGG + Intronic
1188140754 X:26547731-26547753 AAGGATAGTTACCAGAGGCTGGG - Intergenic
1188202634 X:27309846-27309868 TAGGAGGGTTACCAGAGGCTGGG - Intergenic
1188419130 X:29975040-29975062 AAGGATGGTTTCCAGAGGCTGGG - Intergenic
1188827214 X:34850714-34850736 AAGGATCGTTACCAGAGGATAGG - Intergenic
1188931495 X:36116913-36116935 AAGGATAGTTACCAGAGGCTAGG - Intronic
1189585063 X:42451719-42451741 AAGGATAGTTACCAGAGGCTGGG + Intergenic
1190037345 X:47037954-47037976 GAGGATGGTTACCAGAGGGTGGG - Intronic
1190296240 X:49029569-49029591 CAGGAGAGTTCCCAGGGGAAGGG + Exonic
1190499889 X:51064029-51064051 TAGCACAGTTTCCATAGGATTGG - Intergenic
1190806317 X:53840908-53840930 AAGGAAGGTTACCAGAGGATGGG + Intergenic
1190952602 X:55161416-55161438 GAGGAGAATGTCCATGGGATTGG - Intronic
1191051897 X:56202593-56202615 AAGGATAGTTTCCAGAGGCTGGG - Intergenic
1192844827 X:74895766-74895788 AAGGATAGTTACCAGAGGCTGGG + Intronic
1193204253 X:78729332-78729354 AAGGAGAGTTTCTACAGCATTGG - Intergenic
1193296290 X:79835730-79835752 AAGGATAGTTACCAGAGGTTGGG - Intergenic
1193336903 X:80300518-80300540 TAGGATGGTTTCCAGAGGCTGGG - Intergenic
1194446685 X:93996113-93996135 AAGGATAGTTACCAGAGGAAGGG - Intergenic
1194770241 X:97894343-97894365 AAGGATGGTTACCAGAGGATGGG - Intergenic
1194774785 X:97949049-97949071 TAGGAGGGTTACCAGAGGCTGGG + Intergenic
1194992379 X:100558473-100558495 AAGGATAGTTACCAGAGGCTGGG + Intergenic
1195118015 X:101719212-101719234 AAGGATGGTTACCAGAGGATGGG + Intergenic
1195136959 X:101918014-101918036 AAGGATAGTTACCAGAGGCTGGG + Intronic
1195495720 X:105530744-105530766 AAGGATAGTTACCAGAGGCTGGG - Intronic
1196523450 X:116702304-116702326 GAGGAAGGTTACCAGAGGCTGGG - Intergenic
1196798392 X:119520917-119520939 CAGGATAGTTACCAGAGGCTGGG + Intergenic
1197449152 X:126589676-126589698 AAGGATGGTTTCCAGAGGTTGGG - Intergenic
1197524327 X:127544113-127544135 GAGAAGCCTTTCCAAAGGATGGG - Intergenic
1198027828 X:132725990-132726012 AGGGATAGTTACCAGAGGATGGG + Intronic
1198191024 X:134306114-134306136 AAGGAGGGTTACCAGAGGCTGGG + Intergenic
1199128771 X:144159047-144159069 GAGGACATTTACCAGAGGCTGGG + Intergenic
1199568405 X:149242624-149242646 GATGATGGTTACCAGAGGATGGG - Intergenic
1199596956 X:149513529-149513551 CAAGAGAGTTTCCAGAACATAGG + Intronic
1199880436 X:151970312-151970334 GAGCTGATTTTCCAGAGGCTGGG + Exonic
1201167323 Y:11221584-11221606 ACTGAGAGTTTCCAGAGGCTGGG + Intergenic
1201620389 Y:15950570-15950592 GAGCAAACTTTCCAGAAGATGGG + Intergenic