ID: 950797749

View in Genome Browser
Species Human (GRCh38)
Location 3:15524087-15524109
Sequence CTGTATGTGCAGAGGCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 292}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950797749_950797755 4 Left 950797749 3:15524087-15524109 CCTTGGAGCCTCTGCACATACAG 0: 1
1: 0
2: 1
3: 26
4: 292
Right 950797755 3:15524114-15524136 GTGGCCTGCGCCTGATACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 63
950797749_950797756 7 Left 950797749 3:15524087-15524109 CCTTGGAGCCTCTGCACATACAG 0: 1
1: 0
2: 1
3: 26
4: 292
Right 950797756 3:15524117-15524139 GCCTGCGCCTGATACAAGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 57
950797749_950797761 23 Left 950797749 3:15524087-15524109 CCTTGGAGCCTCTGCACATACAG 0: 1
1: 0
2: 1
3: 26
4: 292
Right 950797761 3:15524133-15524155 AGGGAGGGCTTTGGTGAGTATGG 0: 1
1: 0
2: 2
3: 28
4: 278
950797749_950797754 3 Left 950797749 3:15524087-15524109 CCTTGGAGCCTCTGCACATACAG 0: 1
1: 0
2: 1
3: 26
4: 292
Right 950797754 3:15524113-15524135 GGTGGCCTGCGCCTGATACAAGG 0: 1
1: 0
2: 0
3: 8
4: 81
950797749_950797760 14 Left 950797749 3:15524087-15524109 CCTTGGAGCCTCTGCACATACAG 0: 1
1: 0
2: 1
3: 26
4: 292
Right 950797760 3:15524124-15524146 CCTGATACAAGGGAGGGCTTTGG 0: 1
1: 0
2: 2
3: 6
4: 161
950797749_950797758 8 Left 950797749 3:15524087-15524109 CCTTGGAGCCTCTGCACATACAG 0: 1
1: 0
2: 1
3: 26
4: 292
Right 950797758 3:15524118-15524140 CCTGCGCCTGATACAAGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950797749 Original CRISPR CTGTATGTGCAGAGGCTCCA AGG (reversed) Intergenic
900035540 1:405016-405038 CAGTAAATGCAGAAGCTCCAAGG + Intergenic
900057161 1:640766-640788 CAGTAAATGCAGAAGCTCCAAGG + Intergenic
900862406 1:5242978-5243000 CTGGGTGGGCCGAGGCTCCATGG + Intergenic
901119366 1:6877910-6877932 ATGTATGGTCAGATGCTCCAAGG - Intronic
901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG + Intergenic
901690725 1:10971477-10971499 CAGTATGTGCAGAGGCCCTGAGG - Intronic
902149767 1:14433904-14433926 CTGGATGTGCACATGCACCAGGG + Intergenic
902203552 1:14851472-14851494 TTGCATGTGCAGAGGGCCCATGG + Intronic
902733213 1:18383532-18383554 CTGGCTGTGCAGAGGCCCCCTGG + Intergenic
902819861 1:18937258-18937280 CTGTCTGTGCAGAGCCGTCATGG + Intronic
903065476 1:20697006-20697028 CTGTTTGGGGAGAGGCTCGATGG - Intronic
904251161 1:29225292-29225314 CTGCATGTGCAGAGACCCCGAGG - Intronic
904323558 1:29712236-29712258 TTGTCTGTGCAGAGGATGCAGGG + Intergenic
904330957 1:29757549-29757571 CTGCGTGACCAGAGGCTCCAGGG + Intergenic
904415719 1:30360043-30360065 CTGCATGACCAGAGGCTCCAGGG - Intergenic
904752872 1:32751923-32751945 AGGTATGTGAAGAGGCTCAAAGG - Intronic
904824562 1:33265943-33265965 CTGCATGTGCAAAGGCCCCGAGG - Intronic
906016620 1:42587548-42587570 ATGTAAGTGCAGACTCTCCAAGG - Intronic
907559679 1:55377060-55377082 CAGCAGGTGCAGAGGCTCCAAGG + Intergenic
907832523 1:58078548-58078570 TTGTTTGAGCAGAGGCTGCAGGG - Intronic
907904116 1:58768710-58768732 CTATATGTGCTGATTCTCCATGG - Intergenic
910762850 1:90751955-90751977 GAGTAGGTGCAGAGGCTCCAAGG - Intergenic
912304896 1:108557454-108557476 GTGTCTGTGCAGAGGCTCAAAGG - Intergenic
912332809 1:108834895-108834917 CTGTGTCTGCTGGGGCTCCAGGG + Intronic
912698995 1:111862106-111862128 CTGTCTGGGCAGAGTCTCTAGGG - Intronic
914317829 1:146530797-146530819 CTGTAGGGGCAGAGCCTTCAGGG - Intergenic
914496527 1:148202561-148202583 CTGTAGGGGCAGAGCCTTCAGGG + Intergenic
915146716 1:153799942-153799964 CTGGATCTGGAGAGGGTCCAGGG + Intergenic
916589505 1:166176701-166176723 GTGAATGTGCAGAGGCTAGAGGG - Intergenic
919195414 1:194278661-194278683 TTGTAGGTGCAGAGGGTACATGG - Intergenic
921079590 1:211727907-211727929 CTGTGTGTGCATATGCTCTAAGG + Intergenic
921312261 1:213855967-213855989 CTGCCTGGGCAGAGGCTGCAGGG + Intergenic
921431721 1:215073559-215073581 TTGTATGTGTGGAGGCTCTAAGG + Intronic
922178873 1:223218020-223218042 CTGCATGTGCAGAGATTACATGG - Intergenic
922180490 1:223229135-223229157 CACTATGTGCAGATGGTCCAAGG + Intronic
922566466 1:226604762-226604784 CTGTTGGTTCAGAGGCTGCAGGG + Exonic
922812740 1:228426875-228426897 ATGTATGTGCAGAGGTCACAGGG - Intergenic
923381447 1:233423534-233423556 CAGTGTGTGCAGAGGTTACATGG + Intergenic
924421368 1:243913209-243913231 CTGTCTGTGCAGTGGCTCACTGG - Intergenic
924450271 1:244172392-244172414 CTGTACGTGCCAAGGCTCCAGGG + Intergenic
1063625564 10:7686402-7686424 CAGTATGAGCAAAGGCTCCCAGG - Intergenic
1066301753 10:34103436-34103458 GTGGATGTGCAGAGCCTCCCGGG - Intergenic
1067044545 10:42976877-42976899 CTGTGAGTGCAGAGGCTCTTTGG - Intergenic
1067773430 10:49144117-49144139 CTGGATGGGAAGAGGCTCCTGGG + Intergenic
1069822152 10:71234845-71234867 CTCTATTTGCAGAGGTCCCAGGG + Intronic
1070011256 10:72476675-72476697 CTGTATCTGGAGAAGCACCATGG + Intronic
1070507305 10:77125419-77125441 CTGCATGTGCAGAGGCCCTGGGG - Intronic
1071524449 10:86350088-86350110 CAGCATGTGCAAAGGCCCCAGGG + Intronic
1072115499 10:92366736-92366758 CTGTGTGTGCAGAGACACCTGGG + Intergenic
1072565824 10:96615862-96615884 CTGTTTGTGCACAGCTTCCACGG - Intronic
1073074174 10:100813174-100813196 CTGTGGGTGCAGTGGCTCCAGGG - Intronic
1073566088 10:104536786-104536808 CTGTGTCTGGAGAGTCTCCAAGG + Intergenic
1074189362 10:111122649-111122671 CTGGATGTGCATATGCCCCAGGG + Intergenic
1074985942 10:118659388-118659410 CAGTATTTGCAGTGTCTCCATGG + Intergenic
1076312798 10:129520661-129520683 GTGTATGTGCAGAGCCCCTACGG + Intronic
1077193989 11:1270200-1270222 GTGTGTGGGCACAGGCTCCAGGG - Intergenic
1078620275 11:12900882-12900904 CTGGGGATGCAGAGGCTCCATGG - Intronic
1078900692 11:15639696-15639718 CTGTAATAGCAGTGGCTCCAAGG - Intergenic
1079088966 11:17467491-17467513 CAGCATGTGCAAAGGCCCCAAGG - Intronic
1079846942 11:25484465-25484487 CTGCAAGCGCAAAGGCTCCAAGG - Intergenic
1080020979 11:27559821-27559843 TTGTATGGGCTGAGACTCCATGG + Intergenic
1080751210 11:35152105-35152127 CTGAGAATGCAGAGGCTCCAGGG - Intronic
1081358598 11:42144607-42144629 CTGCAGGTGCAGAGGCCTCATGG - Intergenic
1082940781 11:58703314-58703336 CTGGTGGTGCAGAGGCTCAAAGG - Intronic
1083868415 11:65471469-65471491 CTGTATTTGGAGAGGCTGAAGGG + Intergenic
1087981271 11:104617503-104617525 CTCTATGGGCATAGGCTCAAGGG + Intergenic
1088325660 11:108598399-108598421 CTGGAAATGCAGAGGCACCAAGG + Intergenic
1088729377 11:112667396-112667418 GTGTAGGTCCAGAGGCTGCAAGG - Intergenic
1088910108 11:114184342-114184364 CAGTATGTGCTGATTCTCCAAGG + Intronic
1089505865 11:118961524-118961546 CTGAAGGTGCAGAGACACCAGGG + Intergenic
1089678494 11:120106422-120106444 CAGGATGTGCAGAGGATGCAGGG - Intergenic
1090179676 11:124685439-124685461 CTGCAGGTGCAGAGCCCCCATGG + Intronic
1091179557 11:133591407-133591429 CTGTATGTGGTCAGGGTCCAGGG - Intergenic
1091348522 11:134873261-134873283 CTGTGTGTGCAGAGACCACATGG - Intergenic
1092890850 12:12967978-12968000 ATGTATCTGCAAAGGCTCCACGG - Intergenic
1093135083 12:15440011-15440033 CCCTGTGTGCAGAGGCTACAGGG + Intronic
1093313193 12:17617309-17617331 CTGTAGGGGCAGAGCCTCCATGG - Intergenic
1093946456 12:25115185-25115207 CTGTATGTGCTGAGGCCCAGAGG - Intronic
1096152850 12:49325489-49325511 CTTTCCTTGCAGAGGCTCCAGGG + Exonic
1097245509 12:57605414-57605436 CTGTATGGGCTGAGACTCTAGGG + Intronic
1098284100 12:68890803-68890825 CTCTATGTGGAGAGTCTCAATGG + Intronic
1102571734 12:113830923-113830945 GTGTAAGTGCAAAGGCTCGAGGG + Intronic
1103041455 12:117698879-117698901 CTGTATGTGCAAAGGCCCTGGGG - Intronic
1103189762 12:118991276-118991298 CAGCATGTGCAAAGGCTCCATGG - Intronic
1103962362 12:124617121-124617143 CTGCATGTGCAAAGGCCCCAGGG - Intergenic
1104068578 12:125326093-125326115 GGGTTTGTGCAGAGGCTCCCTGG - Intronic
1104828418 12:131731277-131731299 CAGAATCTGCAGAGGTTCCAGGG + Intronic
1106097493 13:26660930-26660952 CTGTGTGTGCAGAGGTCACATGG + Intronic
1107169003 13:37317402-37317424 CTGTAGGTGGGGAGGCTTCAGGG + Intergenic
1107553316 13:41496570-41496592 CTCTATGCCCAGAGGCTGCAGGG + Intergenic
1107566543 13:41611042-41611064 CTAAATGAGCAGAGGCACCAGGG - Intronic
1111878508 13:93925842-93925864 CAGTATGTGGAGAAGATCCAAGG - Intronic
1112406301 13:99123657-99123679 GTGTAAGTGCAAAGGCTTCACGG - Intergenic
1112850335 13:103698584-103698606 CTGTATGTTCACATACTCCAAGG + Intergenic
1113777813 13:112958708-112958730 CTGCATGAGGAGAGGCCCCAGGG - Intronic
1114658670 14:24331214-24331236 CTCTATGTCAAGAGGCACCAGGG - Exonic
1115831681 14:37349531-37349553 CAGTAAGTGCAAAGGCCCCAAGG - Intronic
1118707143 14:68490943-68490965 GTTAATGAGCAGAGGCTCCAGGG - Intronic
1119605406 14:76011889-76011911 CGGTATGTGCATACGCTTCAGGG - Intronic
1121861815 14:97325710-97325732 CTGTTTCTGCAGGTGCTCCATGG + Intergenic
1124011565 15:25843292-25843314 CAGTGTGTGCAGAGGCTCCCAGG + Intronic
1124705710 15:31962206-31962228 CTGTATGTGCAGAGATCACATGG - Intergenic
1124858931 15:33418940-33418962 CTTTATTTCCAGAAGCTCCAAGG + Intronic
1125544893 15:40495997-40496019 CAGCATGTGCAGAGGCTCTGTGG - Intergenic
1125731485 15:41894813-41894835 CTGTCGCTTCAGAGGCTCCAGGG - Intergenic
1125926579 15:43568122-43568144 CTGAAGGTTCAGAGTCTCCATGG + Intronic
1125939723 15:43667687-43667709 CTGAAGGTTCAGAGTCTCCATGG + Intronic
1128930699 15:71702687-71702709 CTGTCTGTGCAAAGGCCCCGTGG - Intronic
1130403955 15:83581471-83581493 CTCTCTCTGCAGGGGCTCCAAGG - Intronic
1130438463 15:83926220-83926242 CAGTATGTGCAAAGGCCCCAAGG + Intronic
1130990131 15:88871190-88871212 AAGCATGTGCAGAGGCTCCCAGG + Intronic
1131153081 15:90059216-90059238 CAGCCTGTGCAGAGGCCCCAAGG + Intronic
1131340843 15:91599221-91599243 CAGTATGTGCAGAGAGTCCAGGG - Intergenic
1132466613 16:80313-80335 CTGGTTCTCCAGAGGCTCCAAGG + Intronic
1133033690 16:3023343-3023365 CTGCTTGCGCAGAGGCTCCCTGG + Exonic
1137719561 16:50620136-50620158 CTTTATGTACAGTGGCGCCAAGG + Intronic
1140831883 16:78759477-78759499 CTGTATGTCAAGAGGCTTCAAGG - Intronic
1141139965 16:81490958-81490980 CTGGCTGTGTGGAGGCTCCAAGG + Intronic
1142055812 16:87995195-87995217 CTGGATGTGCGGGGGCTCCCGGG + Intronic
1142956953 17:3528954-3528976 CAGCGTGTGCAGCGGCTCCAGGG + Exonic
1144939993 17:18932260-18932282 TTGTTTGTGCAGAAGCACCAAGG + Intergenic
1145252289 17:21303193-21303215 CTTGCTGTGCAGATGCTCCAGGG - Exonic
1148475675 17:47927142-47927164 TCTTAGGTGCAGAGGCTCCAGGG + Intronic
1149899767 17:60464373-60464395 CAGTATGTGCAAAGGCTTCTGGG - Intronic
1150008555 17:61485236-61485258 CTGTGAGCTCAGAGGCTCCACGG - Intergenic
1150509410 17:65734058-65734080 CTGTATCTGCAGTGGGTCCTGGG - Intronic
1151390910 17:73786138-73786160 CTGTATGTCCAGAGGGTCAGGGG - Intergenic
1152584858 17:81184365-81184387 CTGGAGGTGCAAAGGCCCCAGGG - Intergenic
1155261204 18:24044243-24044265 GTGGATGTGCAGAGGCTGCGAGG + Intronic
1155517795 18:26640554-26640576 GTGTATGTGCAGATGCATCATGG - Intronic
1160841148 19:1147553-1147575 CTGTATGTGCAGCGGGGCCATGG - Intronic
1161978098 19:7617231-7617253 CCCTATGTGCAGAGGGGCCAAGG - Intronic
1162106676 19:8373961-8373983 CTGCCTGGGCAGGGGCTCCAAGG + Exonic
1162309792 19:9899407-9899429 CTGCATGTGCAGAGGCCCTGAGG - Intronic
1163518274 19:17778060-17778082 CAGCATGTGCAAAGGCCCCAGGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163745163 19:19042517-19042539 CTGTATTTGCAGAAGTTCTAGGG + Intronic
1166167916 19:41005354-41005376 ATGTAAATGCAGAGGCTGCATGG + Intronic
1166289272 19:41851323-41851345 CTGTATGTGAAGGGGAGCCAGGG + Intronic
1167355804 19:49003318-49003340 CTCTACCTGCCGAGGCTCCAAGG - Exonic
925448004 2:3944188-3944210 CTGTGTGTGCAGTGGCTTCAGGG - Intergenic
925769627 2:7269336-7269358 CTGTATTTGCAGAAGCTACTAGG - Intergenic
927109538 2:19854516-19854538 CAGTAAGTGCAAAGGCCCCAAGG + Intergenic
927149454 2:20187383-20187405 GTGTATCTACAGATGCTCCAGGG - Intergenic
928288235 2:30012148-30012170 CTGTGTGTGCAGAGGTCTCATGG - Intergenic
931803126 2:65778164-65778186 CTGTGTGTGCAGAGACCACAGGG + Intergenic
933993028 2:87647259-87647281 CTGTCTCTGCAGAGGCCCCTTGG - Intergenic
935406171 2:102711922-102711944 CAGTATGTGCAGAGGTTGTATGG + Intergenic
935631415 2:105215585-105215607 CAGTAAGAGCAGAGGCTACAAGG - Intergenic
936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG + Intergenic
937064154 2:119004679-119004701 CTGTATGTACAGTGTCTGCAAGG + Intergenic
937331864 2:121036158-121036180 CTGTATTTGCAGAGCTGCCAGGG + Intergenic
937569041 2:123334022-123334044 CTCCCTGTGCAGAGCCTCCATGG + Intergenic
937993554 2:127677108-127677130 CTGGAGATGCAGAGGCTTCAAGG + Intronic
938917785 2:135960750-135960772 TTGTGTGTGCAGTGGCTCTAAGG - Intronic
941690586 2:168497566-168497588 CAGTAAGTGCAGTGGCCCCATGG + Intronic
945273314 2:207963231-207963253 CTGCATATGCAAAGGCTCTAAGG + Intronic
945663816 2:212717728-212717750 ATGGAAGAGCAGAGGCTCCAGGG - Intergenic
948058792 2:235028830-235028852 CTGCATGTGCAAAGGCCCCGTGG + Intronic
948217715 2:236244241-236244263 CTATATGAGCAGAGGCTGGAGGG + Intronic
948525145 2:238566822-238566844 CTGGACGTGCAGAGCCTCCTGGG + Intergenic
948612234 2:239177253-239177275 CTGCAAGTGCAGAGGCTCAGCGG - Intronic
1169265064 20:4162424-4162446 CTGCACGTGCAGAGGCTCAGAGG - Intronic
1170183224 20:13556694-13556716 CTGCATGTGCAGAGGCCCTGTGG - Intronic
1171389889 20:24794623-24794645 CTCTCTGTGCAGAGGCTTCTGGG - Intergenic
1171399025 20:24859681-24859703 GGGCATCTGCAGAGGCTCCAAGG + Intergenic
1172912794 20:38422339-38422361 TGCTGTGTGCAGAGGCTCCATGG - Intergenic
1172938832 20:38640731-38640753 CAGCAAGTGCAGAGGCCCCAGGG - Intronic
1172962771 20:38810188-38810210 CAGCATGTGCAGAGGCACCGAGG + Intronic
1173144662 20:40514235-40514257 CTGCCTGTGCAAAGGCCCCAAGG - Intergenic
1173771933 20:45667159-45667181 CTCACTGTGCAGGGGCTCCATGG - Exonic
1173920208 20:46738802-46738824 CAGCACGTGCAGAGGCCCCAAGG + Intergenic
1174384767 20:50180687-50180709 CAGCATGTGCAGAGGCCACATGG + Intergenic
1174410562 20:50332228-50332250 CTGCATGTGCAGAGGTCCCGAGG - Intergenic
1174803324 20:53583675-53583697 CTGTATGTGCAAAATCTCTAAGG - Intronic
1175204773 20:57303108-57303130 CTGCAGGTGCAGATGTTCCAAGG - Intergenic
1175955497 20:62606966-62606988 CTGCAGGTGCAGAGTCCCCAGGG - Intergenic
1177108534 21:16993520-16993542 GTGCATGTCCAGAGGCCCCAAGG + Intergenic
1177394082 21:20510831-20510853 CTGCAGGGGCAGAGGCCCCATGG - Intergenic
1178636363 21:34307460-34307482 CTGTCTGTGCTCAGGCTCCCCGG + Intergenic
1178702022 21:34841663-34841685 CAGTAAGTGCAAAGGCCCCAGGG - Intronic
1179484203 21:41699315-41699337 CTGAGTGTGCAAATGCTCCAAGG + Intergenic
1179821742 21:43941011-43941033 CTGTTTCTGCAGAGGGTCAAAGG + Intronic
1180001740 21:44998278-44998300 TGGCATGGGCAGAGGCTCCAAGG - Intergenic
1180561346 22:16616954-16616976 CTGTATGTGCAAAATCTCTAAGG + Intergenic
1180605630 22:17057025-17057047 CTGGATGTGCAGGGGCTCCCTGG - Intergenic
1180682479 22:17638241-17638263 CTGGCTGAGCAGAGGCGCCAGGG - Intronic
1181090116 22:20466820-20466842 CAGTAAGTGCAGGGGCTCCCAGG + Intronic
1181129304 22:20721019-20721041 CTGCTTCTGCAGAGTCTCCATGG - Intronic
1181545365 22:23599361-23599383 CTGAATGGGCAGAGGATGCAGGG - Intergenic
1181682028 22:24501932-24501954 CTGGAGGTGCAGAGGCTCTGGGG - Intronic
1182233369 22:28856209-28856231 CTGTCTATGCACAGCCTCCATGG - Intergenic
1182776559 22:32835587-32835609 TGGTATGTGCAAAGGCCCCAAGG + Intronic
1183534310 22:38388048-38388070 CTGTATGTGCAAAATCTCTAAGG - Intronic
1184093628 22:42305108-42305130 CTGCATGGGGAGGGGCTCCAGGG - Intronic
1184486651 22:44783770-44783792 CTGTACCTCCGGAGGCTCCAGGG + Intronic
1184595029 22:45508682-45508704 CTGCCTCTGCAGAGGCTGCATGG + Intronic
1184865428 22:47199452-47199474 GTGCTAGTGCAGAGGCTCCAGGG - Intergenic
1185314948 22:50174947-50174969 CTGCAGGTGCAGCGGGTCCAGGG + Intronic
949171119 3:998430-998452 CTGAACATGCAGAGGCTCCTGGG + Intergenic
949379723 3:3431289-3431311 CAGCATGTGCAAAGGCTCCTGGG - Intergenic
950423774 3:12913874-12913896 CTGTCTGGCCAGAGGCTCCCAGG - Intronic
950457203 3:13099860-13099882 CGGCATGTGCAAAGGCCCCAAGG + Intergenic
950797749 3:15524087-15524109 CTGTATGTGCAGAGGCTCCAAGG - Intergenic
950961972 3:17117076-17117098 GAGCATGTGCAGAGGCTCTAAGG + Intergenic
950983256 3:17331817-17331839 CAGCATGTACAAAGGCTCCATGG + Intronic
950983423 3:17333330-17333352 CTGTTTCTGCAGAGGTTCAAGGG - Intronic
952307574 3:32159595-32159617 CTGAATGGGCAAAAGCTCCAAGG + Exonic
953405131 3:42656182-42656204 CTGCAGGTGCAGTGGCTCTAGGG + Intronic
955104328 3:55882234-55882256 CTGTATGTGCAGAGATCACATGG - Intronic
956200675 3:66702367-66702389 CGGTCAGTCCAGAGGCTCCATGG - Intergenic
956368235 3:68529673-68529695 CTGTGTGTGCAGAGACCACATGG + Intronic
956891223 3:73616124-73616146 CTGCATGTGCAGAGATTACATGG - Intronic
960268768 3:115651324-115651346 CCGTATGTGCAGAGTGTGCATGG - Intronic
961506669 3:127374858-127374880 CTGTGGGTGGAGATGCTCCATGG - Intergenic
961738983 3:129020765-129020787 CTGTGAGCCCAGAGGCTCCAGGG + Intronic
962292420 3:134147662-134147684 CTGTGGGTGCAGAGGCGCAAAGG - Intronic
962682071 3:137810636-137810658 ATCTATGTGCAGAGGCCCCCTGG - Intergenic
963075134 3:141339134-141339156 CAGTAGGTGCAAAGGCTCTAAGG + Intronic
966747978 3:183296431-183296453 CAGCATGTGCAAAGGCTTCAGGG - Intronic
967761538 3:193231381-193231403 CTGGACGTGCTGTGGCTCCATGG - Intergenic
969037342 4:4265339-4265361 CTGTAAGTGCAGTTGCTCCAGGG - Intergenic
971026513 4:22594100-22594122 CAGAATGTTCAGAGGCGCCAGGG + Intergenic
971571860 4:28222637-28222659 CTGTAAGTGCATAGGCTCTGGGG - Intergenic
972456987 4:39264458-39264480 CTGCAGGTGCAGAGGCTCTCAGG - Intronic
973056734 4:45668819-45668841 CTGACTGTGTAGAGGCTCTAAGG + Intergenic
973811817 4:54578187-54578209 CGGTATGTTCTGAGACTCCATGG - Intergenic
975789242 4:77930546-77930568 CTGTATTTGCAGTGGCTCCCCGG - Intronic
979286980 4:118937309-118937331 AGGTATGTGCAGAGGTCCCAAGG - Intronic
980386084 4:132089272-132089294 CTGCAGGTGCAGAGCCTTCATGG + Intergenic
980609723 4:135142909-135142931 TTGTATGTGCACAGTCTCTATGG + Intergenic
982594059 4:157354966-157354988 CTGTGCATGCAGTGGCTCCAGGG + Intronic
982636126 4:157898974-157898996 CTGCATGTGGAGAGACTCCTAGG + Intergenic
984822909 4:183898658-183898680 CTGAATGGGCAGAGGTACCATGG + Intronic
985694200 5:1330844-1330866 CTGTTTGTCCTGTGGCTCCATGG - Intronic
986787185 5:11125230-11125252 CTCTAGGTGCAGAGGTTGCAGGG + Intronic
990647482 5:57860700-57860722 CAGGATGTGCAGAGGCACAAAGG + Intergenic
992003755 5:72459091-72459113 CTGTTTGTGCAGAGCCCACAAGG + Intronic
997675207 5:135707561-135707583 CAGCAGGTGCAAAGGCTCCAGGG - Intergenic
998226364 5:140329802-140329824 CTGCAGGTTCAGAGGCTCCTAGG + Intergenic
998811726 5:145973177-145973199 CAGCATGTGCAAAGGCTCTAAGG + Intronic
999971132 5:156864526-156864548 CTGTATGTGCAAAGGCCCTGAGG + Intergenic
1000098784 5:157994646-157994668 CTGCAAGTGCAAAGGCTCCGAGG + Intergenic
1000359491 5:160434007-160434029 CTCTGTGTGCACAGGCTCCTGGG + Intergenic
1000610621 5:163369622-163369644 TTTTATGTGCTGAGGATCCAGGG - Intergenic
1001225525 5:169941476-169941498 CTGCAGGTGCAAAGGCCCCATGG + Intronic
1002062106 5:176631222-176631244 GTGCAAGTGCAAAGGCTCCAAGG + Intronic
1002174733 5:177395398-177395420 CAGTATGTGCAAAGGCTCAGAGG + Intronic
1002571326 5:180140835-180140857 CAGCATGTGCAGAGGCTCGGCGG + Intronic
1002738279 5:181413855-181413877 CAGTAAATGCAGAAGCTCCAAGG - Intergenic
1003444441 6:6171844-6171866 CTGTATGTGCAAAGGCCCTGGGG - Intronic
1004902140 6:20204675-20204697 GTGTGTGTGCAGAGGCTGGAGGG + Intronic
1005147219 6:22705280-22705302 CTGCATTTGAACAGGCTCCAAGG + Intergenic
1006402105 6:33823839-33823861 CTATTTGTGCAGAAGCTCCTAGG + Intergenic
1007421888 6:41724581-41724603 CTGGGTGTGCAGAGCCCCCAGGG + Intronic
1008789380 6:55211708-55211730 CTGTATGTGCAAAGGCTTAAAGG - Intronic
1009758301 6:67970083-67970105 CTGTATGTGCATTGGCCCCATGG - Intergenic
1010595782 6:77762184-77762206 CTACATCTGCAGAGGGTCCATGG - Intronic
1013079912 6:106803143-106803165 ATGTTTGTGCAGAGCTTCCAGGG - Intergenic
1015449520 6:133348952-133348974 CTGTTTGTGTAGAGCCTCAAAGG - Intronic
1017282627 6:152640116-152640138 CAGCATATGCAGAGGCTCTATGG + Intergenic
1018754594 6:166838027-166838049 CTGCATGAGCACAGGCTCCTTGG + Intronic
1019243381 6:170689407-170689429 CAGTAAATGCAGAAGCTCCAAGG - Intergenic
1019412998 7:914702-914724 TTGTGTGTTCAGGGGCTCCAGGG - Intronic
1019522965 7:1468840-1468862 CTGCATCTGCTGAGCCTCCAGGG + Intergenic
1019627905 7:2030534-2030556 CTTGATGTGCAGAGGCCCCTGGG + Intronic
1020003928 7:4771782-4771804 CTGTATGTCCAGGGGCTCAGGGG - Intronic
1020003958 7:4771877-4771899 CTGTATGTCCAGGGGCTCAGGGG - Intronic
1023868080 7:44248340-44248362 CGGTGTGTGCAGGGGCTCCGTGG - Intronic
1024084586 7:45882905-45882927 CTGTATGTGCAGGGGCAACTGGG - Intergenic
1024250399 7:47501801-47501823 ATGTATGAGCAGAGCCTTCATGG + Intronic
1025727107 7:64075857-64075879 CTACATGTTCAGAGGCTACATGG - Intronic
1027143520 7:75677791-75677813 CAGTGTGTGCAAAGGCTCCAAGG - Intronic
1027144316 7:75683498-75683520 CTGTGTGTGCAGATGCACCCTGG + Intronic
1027200585 7:76061685-76061707 GTGTATGTCCAGAGGCCCCCGGG + Intronic
1031991693 7:128202874-128202896 CTGTCTGTGCAGAGGGTGCCAGG + Intergenic
1033923934 7:146433217-146433239 CTGTGTGTACAAAGGCCCCAGGG - Intronic
1035504741 8:118751-118773 CAGTAAATGCAGAAGCTCCAAGG + Intergenic
1035583838 8:757058-757080 CAGCATGTGCAAAGGCCCCATGG - Intergenic
1036283575 8:7422733-7422755 ATCTTTGTGCAGAAGCTCCAAGG - Intergenic
1036337894 8:7888788-7888810 ATCTTTGTGCAGAAGCTCCAAGG + Intergenic
1036492146 8:9237605-9237627 CTGTATTGGCAGAGAATCCATGG - Intergenic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1037924144 8:22831608-22831630 ATGTGTGTGCAGAGGGTCCAAGG + Intronic
1038261545 8:26000393-26000415 CTGTAAGTGCAGAGACAACAGGG - Intronic
1038591538 8:28842907-28842929 CTGTGTGTGATGAGGCTCAAAGG + Intronic
1038922149 8:32096644-32096666 CCGTATGTGCAGAGATTACATGG + Intronic
1041331259 8:56728265-56728287 AAGTATGTACAGAGGGTCCATGG - Intergenic
1044089223 8:87978466-87978488 CTGGATGGGTAGAGGCTCTAGGG + Intergenic
1044926673 8:97214990-97215012 CTGTATGTGTTAAAGCTCCATGG + Intergenic
1044928772 8:97232238-97232260 CTGTGAGTGGAGAGGCTCCTGGG + Intergenic
1045694307 8:104790840-104790862 CTCTGTGTCCAGAGGCTGCACGG - Intronic
1047732580 8:127738658-127738680 CTGTATGTGGAGCGGCTTCTCGG + Exonic
1048038993 8:130706917-130706939 CTGCATGGGCAGAGCCCCCATGG - Intergenic
1050080164 9:1907474-1907496 CTGTATATGTATAGCCTCCAAGG - Intergenic
1050151821 9:2624354-2624376 GGGTATGTGTAGAAGCTCCAGGG - Intronic
1051035225 9:12736615-12736637 CTGTAAGTTCTGAGGTTCCAGGG - Intergenic
1054955773 9:70908182-70908204 TCGTATGAGCAGAGGCTCCCAGG + Intronic
1055002843 9:71473025-71473047 CTGAATGTGCTCATGCTCCAAGG - Intergenic
1056295836 9:85192264-85192286 GTGTAAGTGCAAAGGCCCCAAGG + Intergenic
1057219573 9:93248731-93248753 CTGTATGTGCAGAAGATACTAGG - Intronic
1058637464 9:107050274-107050296 CAGCATGTGCAAAGGCACCAGGG - Intergenic
1059440510 9:114304227-114304249 CAGCATGTGCAAAGGCCCCATGG + Intronic
1061398939 9:130357987-130358009 AGGTATGTGCAGGGGCCCCAGGG + Intronic
1062303745 9:135890236-135890258 TTGTGTGTGCAGAGGCTCTGTGG - Intronic
1062724609 9:138064767-138064789 CTGGAGCTGCAGAGGCTCCATGG - Intronic
1203603570 Un_KI270748v1:38630-38652 CAGTAAATGCAGAAGCTCCAAGG - Intergenic
1186149565 X:6660062-6660084 CTGTCTGTCCTGAGGCTCGAAGG - Intergenic
1186305047 X:8247333-8247355 CTGTATCTTCACAGGCTCCTTGG - Intergenic
1186483403 X:9913547-9913569 TTGTGTGTGCAGAGGGTCGATGG + Intronic
1188833393 X:34928351-34928373 CTGCATGGGCAGAGCCTTCATGG - Intergenic
1190506737 X:51134074-51134096 CTGCATGCTCAGAGGGTCCAGGG - Intergenic
1195000856 X:100641948-100641970 ACGTCTGTGCAGAGGCTCCAGGG + Intergenic
1195823404 X:108970952-108970974 CTGGATGTGCCCAGGGTCCAGGG + Intergenic
1196756997 X:119166727-119166749 CTGTATGTGCAAAGGCTGCATGG - Intergenic
1197171863 X:123443677-123443699 GTGTCTGTACAGAGGCTTCAGGG + Intronic
1198507686 X:137317570-137317592 CTGCAAGTGCAAAGGCTCTAGGG - Intergenic
1198979328 X:142377136-142377158 CAGTATGTGCAGAGGCTCTGGGG + Intergenic
1199676185 X:150191118-150191140 CTCTCTGTGCAGAGGCTGCTTGG - Intergenic
1200114709 X:153765043-153765065 CGGCATTTGCAGGGGCTCCAAGG + Intronic