ID: 950798466

View in Genome Browser
Species Human (GRCh38)
Location 3:15530513-15530535
Sequence CATCAGAAGAAGACAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950798466_950798473 6 Left 950798466 3:15530513-15530535 CCCTCCCCTGTCTTCTTCTGATG No data
Right 950798473 3:15530542-15530564 TGTTGCTTCTCCTTGAGAGGTGG No data
950798466_950798472 3 Left 950798466 3:15530513-15530535 CCCTCCCCTGTCTTCTTCTGATG No data
Right 950798472 3:15530539-15530561 TGTTGTTGCTTCTCCTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950798466 Original CRISPR CATCAGAAGAAGACAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr