ID: 950798472

View in Genome Browser
Species Human (GRCh38)
Location 3:15530539-15530561
Sequence TGTTGTTGCTTCTCCTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950798466_950798472 3 Left 950798466 3:15530513-15530535 CCCTCCCCTGTCTTCTTCTGATG No data
Right 950798472 3:15530539-15530561 TGTTGTTGCTTCTCCTTGAGAGG No data
950798462_950798472 15 Left 950798462 3:15530501-15530523 CCAAATACCCCACCCTCCCCTGT No data
Right 950798472 3:15530539-15530561 TGTTGTTGCTTCTCCTTGAGAGG No data
950798463_950798472 8 Left 950798463 3:15530508-15530530 CCCCACCCTCCCCTGTCTTCTTC No data
Right 950798472 3:15530539-15530561 TGTTGTTGCTTCTCCTTGAGAGG No data
950798469_950798472 -1 Left 950798469 3:15530517-15530539 CCCCTGTCTTCTTCTGATGGAAT No data
Right 950798472 3:15530539-15530561 TGTTGTTGCTTCTCCTTGAGAGG No data
950798464_950798472 7 Left 950798464 3:15530509-15530531 CCCACCCTCCCCTGTCTTCTTCT No data
Right 950798472 3:15530539-15530561 TGTTGTTGCTTCTCCTTGAGAGG No data
950798461_950798472 18 Left 950798461 3:15530498-15530520 CCACCAAATACCCCACCCTCCCC No data
Right 950798472 3:15530539-15530561 TGTTGTTGCTTCTCCTTGAGAGG No data
950798467_950798472 2 Left 950798467 3:15530514-15530536 CCTCCCCTGTCTTCTTCTGATGG No data
Right 950798472 3:15530539-15530561 TGTTGTTGCTTCTCCTTGAGAGG No data
950798465_950798472 6 Left 950798465 3:15530510-15530532 CCACCCTCCCCTGTCTTCTTCTG No data
Right 950798472 3:15530539-15530561 TGTTGTTGCTTCTCCTTGAGAGG No data
950798471_950798472 -3 Left 950798471 3:15530519-15530541 CCTGTCTTCTTCTGATGGAATGT No data
Right 950798472 3:15530539-15530561 TGTTGTTGCTTCTCCTTGAGAGG No data
950798470_950798472 -2 Left 950798470 3:15530518-15530540 CCCTGTCTTCTTCTGATGGAATG No data
Right 950798472 3:15530539-15530561 TGTTGTTGCTTCTCCTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950798472 Original CRISPR TGTTGTTGCTTCTCCTTGAG AGG Intergenic
No off target data available for this crispr