ID: 950799814

View in Genome Browser
Species Human (GRCh38)
Location 3:15541275-15541297
Sequence TGTGAACAGCACCAAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950799809_950799814 11 Left 950799809 3:15541241-15541263 CCAGATTTCACGATAATTCACTC No data
Right 950799814 3:15541275-15541297 TGTGAACAGCACCAAGGGGATGG No data
950799808_950799814 29 Left 950799808 3:15541223-15541245 CCACACACTTTTAAACAACCAGA 0: 586
1: 1151
2: 1923
3: 1866
4: 1874
Right 950799814 3:15541275-15541297 TGTGAACAGCACCAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950799814 Original CRISPR TGTGAACAGCACCAAGGGGA TGG Intergenic
No off target data available for this crispr