ID: 950801317

View in Genome Browser
Species Human (GRCh38)
Location 3:15553977-15553999
Sequence TCTCCCTACCCAATCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950801314_950801317 11 Left 950801314 3:15553943-15553965 CCTCTTTATGGTGCTCTCACATT No data
Right 950801317 3:15553977-15553999 TCTCCCTACCCAATCACCCCAGG No data
950801313_950801317 12 Left 950801313 3:15553942-15553964 CCCTCTTTATGGTGCTCTCACAT No data
Right 950801317 3:15553977-15553999 TCTCCCTACCCAATCACCCCAGG No data
950801311_950801317 23 Left 950801311 3:15553931-15553953 CCTCTTCATGGCCCTCTTTATGG No data
Right 950801317 3:15553977-15553999 TCTCCCTACCCAATCACCCCAGG No data
950801310_950801317 24 Left 950801310 3:15553930-15553952 CCCTCTTCATGGCCCTCTTTATG No data
Right 950801317 3:15553977-15553999 TCTCCCTACCCAATCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950801317 Original CRISPR TCTCCCTACCCAATCACCCC AGG Intergenic
No off target data available for this crispr