ID: 950802018

View in Genome Browser
Species Human (GRCh38)
Location 3:15560253-15560275
Sequence CTGAAAATACAGAATTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46528
Summary {0: 6, 1: 418, 2: 9235, 3: 22516, 4: 14353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950802018_950802024 7 Left 950802018 3:15560253-15560275 CCCAGCTAATTCTGTATTTTCAG 0: 6
1: 418
2: 9235
3: 22516
4: 14353
Right 950802024 3:15560283-15560305 GGGGTTTCTCCATGTTGGTCAGG 0: 12353
1: 30279
2: 108113
3: 178545
4: 183822
950802018_950802025 11 Left 950802018 3:15560253-15560275 CCCAGCTAATTCTGTATTTTCAG 0: 6
1: 418
2: 9235
3: 22516
4: 14353
Right 950802025 3:15560287-15560309 TTTCTCCATGTTGGTCAGGCTGG 0: 18586
1: 36319
2: 134688
3: 174060
4: 144372
950802018_950802023 2 Left 950802018 3:15560253-15560275 CCCAGCTAATTCTGTATTTTCAG 0: 6
1: 418
2: 9235
3: 22516
4: 14353
Right 950802023 3:15560278-15560300 GAGATGGGGTTTCTCCATGTTGG 0: 6989
1: 57841
2: 113035
3: 132150
4: 96142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950802018 Original CRISPR CTGAAAATACAGAATTAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr