ID: 950802018 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:15560253-15560275 |
Sequence | CTGAAAATACAGAATTAGCT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 46528 | |||
Summary | {0: 6, 1: 418, 2: 9235, 3: 22516, 4: 14353} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
950802018_950802024 | 7 | Left | 950802018 | 3:15560253-15560275 | CCCAGCTAATTCTGTATTTTCAG | 0: 6 1: 418 2: 9235 3: 22516 4: 14353 |
||
Right | 950802024 | 3:15560283-15560305 | GGGGTTTCTCCATGTTGGTCAGG | 0: 12353 1: 30279 2: 108113 3: 178545 4: 183822 |
||||
950802018_950802025 | 11 | Left | 950802018 | 3:15560253-15560275 | CCCAGCTAATTCTGTATTTTCAG | 0: 6 1: 418 2: 9235 3: 22516 4: 14353 |
||
Right | 950802025 | 3:15560287-15560309 | TTTCTCCATGTTGGTCAGGCTGG | 0: 18586 1: 36319 2: 134688 3: 174060 4: 144372 |
||||
950802018_950802023 | 2 | Left | 950802018 | 3:15560253-15560275 | CCCAGCTAATTCTGTATTTTCAG | 0: 6 1: 418 2: 9235 3: 22516 4: 14353 |
||
Right | 950802023 | 3:15560278-15560300 | GAGATGGGGTTTCTCCATGTTGG | 0: 6989 1: 57841 2: 113035 3: 132150 4: 96142 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
950802018 | Original CRISPR | CTGAAAATACAGAATTAGCT GGG (reversed) | Intergenic | ||
Too many off-targets to display for this crispr |