ID: 950804788

View in Genome Browser
Species Human (GRCh38)
Location 3:15590672-15590694
Sequence CACATTTTACACACTGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950804785_950804788 9 Left 950804785 3:15590640-15590662 CCTACCTATGCAAAACAAGGTGA 0: 1
1: 0
2: 1
3: 12
4: 147
Right 950804788 3:15590672-15590694 CACATTTTACACACTGAGCTTGG 0: 1
1: 0
2: 0
3: 23
4: 175
950804786_950804788 5 Left 950804786 3:15590644-15590666 CCTATGCAAAACAAGGTGAAAAA 0: 1
1: 0
2: 4
3: 32
4: 383
Right 950804788 3:15590672-15590694 CACATTTTACACACTGAGCTTGG 0: 1
1: 0
2: 0
3: 23
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950804788 Original CRISPR CACATTTTACACACTGAGCT TGG Intronic
900853751 1:5164328-5164350 CACATTTTACAAATTGAGCCTGG + Intergenic
901469480 1:9446248-9446270 CAGATATTACAAAGTGAGCTGGG - Intergenic
904452517 1:30623360-30623382 CACAGATGACACACTGAGCAGGG - Intergenic
908679783 1:66647946-66647968 AACATCTTGCACACTGAACTTGG - Intronic
909122152 1:71616936-71616958 CACATTATACAAAGTGGGCTTGG - Intronic
909652892 1:77995751-77995773 CTGATTTTAAACACTGAGTTAGG - Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912792566 1:112666798-112666820 CACATTCTAAGCACTGTGCTAGG - Intronic
913441065 1:118898273-118898295 AACATTTTGCACACTGAATTAGG - Intronic
917681877 1:177375688-177375710 GACATTTTACCCATTGTGCTGGG + Intergenic
919330190 1:196161292-196161314 CACATTTTACACAATATTCTAGG + Intergenic
919983215 1:202655514-202655536 CACCGTTTACGCACTGTGCTGGG + Intronic
922597061 1:226822220-226822242 CACACTTTAGATACTGAGATGGG + Intergenic
922907958 1:229189947-229189969 AACATTTCACACTCTCAGCTGGG + Intergenic
923474207 1:234317592-234317614 CACATGGTACTCACAGAGCTGGG - Intronic
1064073783 10:12252430-12252452 CACATTTTAGAAAGTGACCTGGG - Intergenic
1064183640 10:13141411-13141433 CACTTGTTTCACACTGAGCTGGG + Intergenic
1064490657 10:15852318-15852340 CACATTTTTGAGACTGAACTTGG - Intronic
1065159183 10:22901371-22901393 CAGATTAAACACACTGAACTGGG - Intergenic
1065284074 10:24170409-24170431 CAAATTTCACACAATGAGCTTGG - Intronic
1071274823 10:84043872-84043894 CACATTTTATAGGCCGAGCTTGG - Intergenic
1072324620 10:94285745-94285767 CACATTCTCCACTCTGAGCTGGG + Intronic
1074681348 10:115910671-115910693 AACATTTCACTCACTGGGCTGGG + Intronic
1074688058 10:115977863-115977885 CACGTGTTTAACACTGAGCTTGG + Intergenic
1075380455 10:122014563-122014585 CCCATTTTATACACTGAGCATGG - Intronic
1076819553 10:132931623-132931645 CACACTTTTCACACAGAGCCTGG + Intronic
1078510893 11:11983199-11983221 CAAATTTAAGAGACTGAGCTAGG - Intronic
1079924758 11:26480210-26480232 AACACTTTCCACACTGAGCTGGG + Intronic
1080226678 11:29969439-29969461 CACATTTAACTCAGTGAGATTGG - Intergenic
1080261918 11:30358759-30358781 GCCAGTTTACAAACTGAGCTTGG - Intergenic
1080762208 11:35262529-35262551 CACTTTTTAAAAACTGAGATGGG - Intronic
1084043367 11:66555398-66555420 CACATTCTCCACACTGGGCCTGG + Intronic
1085903323 11:80728746-80728768 CACATTTTACACAATTACTTGGG + Intergenic
1087182918 11:95157227-95157249 CACAAATTAGACACTGAGCTGGG + Intergenic
1087283389 11:96237800-96237822 CACATTCTAAACAATGAGCAAGG - Intronic
1088299526 11:108341493-108341515 TACATGTTACACACAGGGCTAGG - Intronic
1091122876 11:133071192-133071214 CACATCTATCTCACTGAGCTTGG - Intronic
1091944703 12:4527417-4527439 CACATCTCACATACTGAGCCAGG - Intronic
1092829304 12:12428326-12428348 AACATTTTACACAAAGAGGTAGG + Intronic
1093551129 12:20413012-20413034 CACAAGTTACATACTGTGCTAGG + Intronic
1095374209 12:41506824-41506846 GACATTTTCCAAACGGAGCTGGG - Intronic
1095702435 12:45204021-45204043 CACATTTCACACACTGCAATTGG - Intergenic
1097967499 12:65596433-65596455 TTCATTTTACCCACTGAGCCTGG + Intergenic
1101217533 12:102599556-102599578 CACATTTCACCCACAGAGCACGG + Intergenic
1101517250 12:105448179-105448201 CACATTATAAACACTCAGCATGG - Intergenic
1102659008 12:114508750-114508772 GACATTTTTCACCATGAGCTGGG + Intergenic
1103809786 12:123604109-123604131 CTGTTTTTAAACACTGAGCTGGG + Intronic
1105465239 13:20633913-20633935 TACATTCTACCCAGTGAGCTGGG + Intronic
1105983597 13:25544350-25544372 CACATTTTAGATATCGAGCTAGG + Intronic
1106819305 13:33445468-33445490 GATATATTACACACTGAGTTTGG + Intergenic
1107290308 13:38844901-38844923 GACATTTCCCACACTGAGGTAGG - Intronic
1109648568 13:65293566-65293588 GATATTTTACACACTGATTTAGG - Intergenic
1111050373 13:82875620-82875642 GACATTTTACTCACTGAAATGGG + Intergenic
1111504981 13:89176044-89176066 CACATTTTAAACACTGGCATGGG - Intergenic
1112701918 13:102019780-102019802 CACACTTTAAATACAGAGCTGGG + Intronic
1112955071 13:105047518-105047540 CACCTCTTCCACACTGAGCCAGG + Intergenic
1115184655 14:30672161-30672183 CACATTTTACAGATAAAGCTAGG + Intronic
1115369653 14:32598054-32598076 CCCATTCTATACACTGTGCTGGG - Intronic
1117018876 14:51549153-51549175 AACATTTCATACACTGAGCTAGG - Intronic
1117027279 14:51634352-51634374 CCTATTTTAGACACTGTGCTAGG - Intronic
1118155021 14:63231581-63231603 CACAAATTAAACACTCAGCTCGG + Intronic
1118952037 14:70443696-70443718 AACATTTGACTCAGTGAGCTGGG - Intergenic
1120088494 14:80303895-80303917 CACAATCCACACACTGTGCTGGG + Intronic
1121634865 14:95447037-95447059 CAGACTTAAAACACTGAGCTAGG + Intronic
1121863011 14:97337151-97337173 CATATTATACAAACTGTGCTGGG + Intergenic
1124367266 15:29081014-29081036 CACATGATCCACACGGAGCTGGG - Intronic
1125965413 15:43871434-43871456 CAGATTCTACAAACTGAGGTAGG + Exonic
1127287760 15:57545882-57545904 CAAATTCTACACCCTGAGTTTGG + Intronic
1127352398 15:58166398-58166420 GACATTTCACACAATGATCTAGG - Intronic
1128555549 15:68629346-68629368 CACATTCCACTCACTGAGCCTGG + Intronic
1128756681 15:70188075-70188097 CACATTTGTGAAACTGAGCTGGG + Intergenic
1128940598 15:71784848-71784870 CACATTGGTCACACTGAGCCCGG - Intergenic
1130051204 15:80485507-80485529 CACATCTAACACACTGTGGTAGG + Intronic
1132089456 15:98936034-98936056 CACATCTTGCGCACGGAGCTGGG - Intronic
1133465592 16:6024225-6024247 CACATGTTAGACCCTGTGCTTGG + Intronic
1134075628 16:11289379-11289401 CACATCTTGCACCCTGATCTTGG - Intronic
1135783541 16:25327521-25327543 CAAAATTTACACACTGAGTCTGG - Intergenic
1138377499 16:56575958-56575980 CAGATTTTATACTCTGACCTAGG + Intergenic
1139682622 16:68576925-68576947 CACACTTTCCACACTCAGCTAGG - Intergenic
1142283800 16:89162810-89162832 AACATTTTACACATTGAGGACGG + Intergenic
1147008726 17:37426134-37426156 CATATTTTAAACTCTGGGCTGGG - Intronic
1148094544 17:45043347-45043369 GACATGTCACACACTGAGTTGGG - Intronic
1152528845 17:80905143-80905165 CACTGTTGACACACTGTGCTGGG - Intronic
1160571844 18:79822815-79822837 CACATTTTCCACAATTACCTGGG + Intergenic
1162016003 19:7846766-7846788 CACATTGCACACACTGGGCCTGG - Intronic
1163251347 19:16128072-16128094 CACATTTTCCACATTGATGTTGG - Exonic
928383447 2:30841539-30841561 TACATTCTAAACACTGAGCTAGG + Intergenic
929396842 2:41533322-41533344 CACACTTTCCACACTTTGCTTGG - Intergenic
930765947 2:55085257-55085279 CACCTATTACACACTGTGTTTGG - Intronic
931819670 2:65938661-65938683 CACATTTTACTCACTTAGCCTGG - Intergenic
936081095 2:109432828-109432850 CACATTTCACCTTCTGAGCTGGG + Intronic
937528275 2:122797495-122797517 CACAGTTTTTACTCTGAGCTTGG + Intergenic
938373780 2:130790851-130790873 CTTTCTTTACACACTGAGCTTGG + Intergenic
940220319 2:151344610-151344632 CACATTTTTCACATTTATCTAGG - Intergenic
940525818 2:154811842-154811864 CACATTTAATACACTAACCTTGG + Intronic
941367541 2:164625445-164625467 CACATTTTGCACACTTCCCTTGG + Intergenic
942327001 2:174784422-174784444 TCCACTTTACACGCTGAGCTTGG - Intergenic
943479047 2:188395537-188395559 CAGATTTTCCCCACTGAGCCTGG + Intronic
943663682 2:190586254-190586276 CACATGTCAGACACTGTGCTGGG - Intergenic
943969042 2:194379667-194379689 CACAGTTTAAACACTCAGCAGGG + Intergenic
944059532 2:195557699-195557721 CTCACTTTACACACTGAGGAAGG + Intergenic
945141133 2:206687202-206687224 CACACTTTTGGCACTGAGCTGGG + Intronic
1170264455 20:14449435-14449457 CCCATGTTAGACACTGTGCTAGG + Intronic
1170744086 20:19082832-19082854 CATATTATACAAAGTGAGCTTGG - Intergenic
1171130801 20:22651612-22651634 CATGTTTTACCCACTGAGTTTGG - Intergenic
1174090501 20:48043334-48043356 CACATTTCAAGCACTGGGCTTGG + Intergenic
1174614246 20:51823755-51823777 TACATTTGAAACACTGTGCTGGG + Intergenic
1178108873 21:29350765-29350787 CACCTTCTACACTCTGACCTTGG - Intronic
1178756583 21:35355642-35355664 CACATTATACATCCTTAGCTTGG - Intronic
1179266423 21:39807495-39807517 CATGATTTACACACTGTGCTAGG - Intergenic
949100809 3:142798-142820 CACATTTAGCACACAGATCTTGG - Intergenic
949832356 3:8229473-8229495 CAGATTTTGCACACAGATCTTGG + Intergenic
950160591 3:10757872-10757894 CATATTTGACACATTGAGGTAGG + Intergenic
950545748 3:13637064-13637086 CACTTCTGATACACTGAGCTGGG - Intronic
950804788 3:15590672-15590694 CACATTTTACACACTGAGCTTGG + Intronic
953896305 3:46805726-46805748 CACATTGTACAGCCTCAGCTAGG + Intronic
957742961 3:84298260-84298282 CACATTTTCAACACTAAGTTTGG - Intergenic
958063498 3:88512968-88512990 AACATTTTACACACTAATCATGG + Intergenic
958102625 3:89034345-89034367 AACTTTTGTCACACTGAGCTGGG - Intergenic
964193318 3:154032012-154032034 TACATTTCACACCCTGAACTAGG + Intergenic
964731036 3:159865180-159865202 ACCATTTTATACACTGAGCAAGG - Intronic
970166507 4:13243607-13243629 CACCTTATAAACACTGAGATGGG - Intergenic
970828417 4:20306403-20306425 CACATTCTACATACTGATGTTGG - Intronic
974595683 4:64012226-64012248 CACATTGGACACACTGAGGGTGG - Intergenic
975141839 4:70926543-70926565 AACAGTTTATACACTGGGCTTGG - Intronic
975429067 4:74267070-74267092 ATCCTTTTACACACTGAGCTTGG + Intronic
976660691 4:87537224-87537246 CACATTTTCCACACTGTGTTTGG + Intergenic
983885766 4:172978606-172978628 CTCATTTTACGCACTGAAATTGG - Intronic
984246659 4:177283093-177283115 TACATATTACACATTAAGCTTGG - Intergenic
987494219 5:18622304-18622326 CATATTTTACACATTGAATTTGG + Intergenic
990324639 5:54662455-54662477 CATTTTTTACACACTCAACTTGG - Intergenic
995731955 5:115254800-115254822 CATGTATTAGACACTGAGCTGGG + Intronic
997290223 5:132726898-132726920 CACTTTTTAGCCACTGACCTTGG + Intronic
998682421 5:144484360-144484382 CTGATTTTACAGACTAAGCTGGG - Exonic
1001452568 5:171837728-171837750 CCCAGTTTACTAACTGAGCTGGG - Intergenic
1003570865 6:7255533-7255555 TAAATTTTCCACACTGAGCAAGG - Intergenic
1003644586 6:7904282-7904304 TACATTTTACACAGTGTGCATGG - Intronic
1004051751 6:12088378-12088400 CAAATTTAACACACTGGTCTAGG - Intronic
1004132553 6:12934417-12934439 TAAATTTTACACACTGACATGGG - Intronic
1004285141 6:14314773-14314795 TAGATTTTAGTCACTGAGCTGGG + Intergenic
1007059260 6:38922179-38922201 CCCATTTTACAAACAGAGCTAGG - Intronic
1007245754 6:40461109-40461131 GAAATTTTACACACTGGGCTGGG + Intronic
1008246831 6:49185897-49185919 CACTTTTCACACACTGGGCTTGG - Intergenic
1008540301 6:52540805-52540827 AACCTTTTACCCACTGAGCTTGG - Intronic
1011826670 6:91314794-91314816 CACATTTTAAAACCTGATCTTGG + Intergenic
1012444749 6:99296458-99296480 CACAGTTCACATTCTGAGCTCGG - Intronic
1013897693 6:115110617-115110639 CACATTTTTAACACGGAGGTTGG + Intergenic
1014530327 6:122551725-122551747 CCCAGTTTTCACACTGTGCTTGG + Intronic
1016642395 6:146364141-146364163 CACACTTTAAACTCTGAACTGGG - Intronic
1017908691 6:158774189-158774211 CAAAGTTTACAGACTGAGGTGGG + Intronic
1018037492 6:159893803-159893825 CACATTTTACACCCAGATCTTGG + Intergenic
1018217496 6:161543832-161543854 TACATTATACTCACTGACCTGGG - Intronic
1018637645 6:165878166-165878188 CACATTTTACAAAATCAGATTGG + Intronic
1018722994 6:166588109-166588131 CCCAATGTACACACTGTGCTGGG + Intronic
1019237903 6:170636236-170636258 CACCTTTAACACACTCATCTGGG - Intergenic
1020852794 7:13377999-13378021 CACATTTTTCTCATTGACCTTGG + Intergenic
1021321209 7:19214491-19214513 CAAGTTTTACACATTGAGGTAGG + Intergenic
1021886087 7:25140885-25140907 AACACTTTAAAAACTGAGCTGGG - Intronic
1022469600 7:30674236-30674258 CAGAGCTTACACAGTGAGCTGGG - Intronic
1024207385 7:47175566-47175588 CACAGTTGGCACACAGAGCTGGG - Intergenic
1024363628 7:48495983-48496005 CTCACTTTACACAATGAGATAGG - Intronic
1027807846 7:82852321-82852343 AACATTTTAGTCAATGAGCTGGG + Intronic
1028003116 7:85526581-85526603 CACATTTTACATACTGTGATGGG + Intergenic
1034359801 7:150484752-150484774 CAAATTTTACATACTTTGCTTGG - Intergenic
1034379410 7:150677526-150677548 CAAATTTTACATACTTTGCTTGG - Intergenic
1035937731 8:3861139-3861161 CACCTTTAACACACTGTCCTTGG + Intronic
1038219136 8:25591135-25591157 CACACTGTACACTCTGAGCTTGG + Intergenic
1039726316 8:40220581-40220603 CACATTTTACAGTCTAGGCTAGG + Intergenic
1044378960 8:91510464-91510486 CACATCTTCCACATTCAGCTAGG + Intergenic
1044818293 8:96135495-96135517 CACATGTTGCACACTAAGCCTGG + Intergenic
1048270761 8:133026374-133026396 CTCCTTTTAAACACTGGGCTGGG - Intronic
1048954254 8:139521752-139521774 AACATTTTCCAAAGTGAGCTTGG + Intergenic
1050110488 9:2210344-2210366 CAGATTATACACACTGAGACTGG - Intergenic
1051513485 9:17905793-17905815 CAGAAGATACACACTGAGCTCGG - Intergenic
1052209444 9:25885209-25885231 CACATTTTTCACAGTCAGTTTGG + Intergenic
1052393169 9:27905186-27905208 CACTTTTTCCACTCTGAGTTGGG - Intergenic
1055609568 9:78007803-78007825 CACATTTTAAAAACTCAGGTTGG + Intronic
1056594586 9:87996348-87996370 CACACTTTCAACACTCAGCTAGG + Intergenic
1057526032 9:95802557-95802579 TACATTTTAAAAACTGAGCTTGG + Intergenic
1061581252 9:131538143-131538165 CACATTTTGCACTCTTTGCTTGG - Intergenic
1062204262 9:135327089-135327111 CACATATGCCACACTGGGCTGGG - Intergenic
1062674274 9:137731209-137731231 GCCATTTTACACACTGTCCTAGG - Intronic
1186897435 X:14018019-14018041 GACATTTTACAGAATGAGCTAGG - Intronic
1188180392 X:27048196-27048218 GACATTTAACACACACAGCTGGG + Intergenic
1189081874 X:37981603-37981625 CAAATTTTAAACATTGACCTAGG + Intronic
1189156334 X:38761018-38761040 CTCATTATACTCACTAAGCTGGG + Intergenic
1189911903 X:45818460-45818482 CACATTCTAAACTCTAAGCTAGG - Intergenic
1190707671 X:53044155-53044177 CACTTCTTCCACACTGACCTTGG + Intergenic
1195039215 X:100998857-100998879 CATATTTCAGACACTGTGCTAGG + Intergenic
1195801162 X:108712589-108712611 CACATTTTCAACATTCAGCTAGG + Intergenic
1196217902 X:113076351-113076373 CACATTTTGCATATTGATCTTGG - Intergenic
1196251038 X:113460193-113460215 CACATTTTCAACACTTAGCTTGG + Intergenic
1197855369 X:130908792-130908814 CACATTCTGAATACTGAGCTGGG - Intergenic
1197997977 X:132400582-132400604 CACATTTTAAACACGTTGCTAGG + Intronic
1200361771 X:155613960-155613982 GACATTTTAGACTCTGTGCTTGG - Intronic
1201676582 Y:16592519-16592541 CACATTTTACCCAATGACCCAGG - Intergenic
1202263783 Y:22996980-22997002 GACATTATAAACTCTGAGCTGGG - Intronic
1202416774 Y:24630722-24630744 GACATTATAAACTCTGAGCTGGG - Intronic
1202454013 Y:25039364-25039386 GACATTATAAACTCTGAGCTGGG + Intronic