ID: 950812915

View in Genome Browser
Species Human (GRCh38)
Location 3:15666814-15666836
Sequence AGATTTGAACAGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 1, 2: 4, 3: 52, 4: 445}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950812915 Original CRISPR AGATTTGAACAGATGGAGAA GGG (reversed) Intergenic
900389039 1:2426171-2426193 ACATCTGCACAGATGGTGAAAGG - Intronic
901743741 1:11359082-11359104 TGCTTGGAACAGATGGAGGAGGG - Intergenic
903046147 1:20565767-20565789 AGATTTGAAATGATGGAGCCAGG + Intergenic
904032785 1:27543545-27543567 AGGTTTGCACACATGGAGACCGG - Intronic
904197776 1:28798687-28798709 AGATTTAGACAGATGCACAAAGG + Intergenic
904321841 1:29702933-29702955 ATGTTTGATCTGATGGAGAAAGG + Intergenic
904766462 1:32852508-32852530 AGTTTAGAACAGATGGAGGTGGG - Intronic
905094664 1:35459211-35459233 AAACTTGAACAGATTGAGAAGGG + Intronic
906255986 1:44350589-44350611 AGACTGGAAAAGATGTAGAAAGG - Intronic
907825912 1:58016741-58016763 AGCTTATTACAGATGGAGAATGG - Intronic
908165626 1:61454886-61454908 AGAGTTGAATGAATGGAGAATGG - Intronic
908445827 1:64198767-64198789 AGATTTAAAAAGAGGAAGAAAGG + Intergenic
908480127 1:64531363-64531385 AGGCTTGAAGAGATTGAGAAGGG + Intronic
908647111 1:66290175-66290197 AGAGTTGCACAGATCTAGAAGGG + Intronic
908697775 1:66864462-66864484 AGGTGTCAACAGATGGAGACTGG + Intronic
908704170 1:66932238-66932260 ATATTTTATCAGTTGGAGAATGG + Intronic
908977476 1:69916441-69916463 AGATTTGAACATACAGAGACTGG + Intronic
911683442 1:100745861-100745883 AGATTTCAACACAGAGAGAATGG + Intergenic
911687865 1:100797747-100797769 TGATTGGAACAGATGGAAAATGG + Intergenic
912592883 1:110844648-110844670 AAAAGTTAACAGATGGAGAAAGG - Intergenic
914228388 1:145741797-145741819 AGATTTTAAGAGAAGGAGCAGGG - Exonic
914720512 1:150285073-150285095 AGAAATGAAAAGAAGGAGAAGGG - Intronic
915281579 1:154826117-154826139 ATATCTGAAGACATGGAGAATGG + Intronic
915314225 1:155018831-155018853 GGATCTGAACAGATGGGGCAGGG - Intronic
916018274 1:160769985-160770007 AGATTGAGCCAGATGGAGAAAGG + Intergenic
916723139 1:167500249-167500271 AGTTTTCATCACATGGAGAATGG - Intronic
918683162 1:187380382-187380404 AGATTTGAAAAGAAGAAGAAAGG - Intergenic
918953043 1:191165115-191165137 AGATTAGAAAACCTGGAGAATGG + Intergenic
921275135 1:213511644-213511666 AGATCTGCATAGCTGGAGAAGGG - Intergenic
922944397 1:229499359-229499381 TGATTTGAACAGTTAGACAAGGG - Intronic
923137521 1:231131415-231131437 AGATTTCAACAGATAGAGATGGG - Intergenic
923397395 1:233580576-233580598 AGACAAGAACAGATGGAGGAAGG - Intergenic
924063333 1:240198618-240198640 ATATTAGAACAGATGGCAAATGG - Intronic
924282257 1:242450331-242450353 AGATTTGAACAAAAGAAGCATGG - Intronic
924299112 1:242619105-242619127 AGAGTTGAACACATGGACACAGG + Intergenic
924525262 1:244840788-244840810 AGATTAGAAGAAATGGGGAAAGG - Intronic
924695156 1:246391806-246391828 TGATATGAACAGCTGGAGACGGG - Intronic
1063051056 10:2448039-2448061 GGATTTTAACTGATGCAGAAGGG - Intergenic
1063581355 10:7310511-7310533 TCATTAGAACAGATAGAGAATGG - Intronic
1064753429 10:18554638-18554660 AGAATGTAACAGATGGAGAATGG + Intronic
1064754103 10:18559247-18559269 AGAATGTAACGGATGGAGAATGG + Intronic
1064754823 10:18564346-18564368 AGAATGTAACAGATGGAGAATGG - Intronic
1064755506 10:18569104-18569126 AGAATGTAACGGATGGAGAATGG - Intronic
1065036850 10:21648159-21648181 TGATTTAAACAGATTAAGAAAGG - Intronic
1065185916 10:23171412-23171434 AGATTTGAGCAGATGGCCCATGG + Intergenic
1066307804 10:34163384-34163406 GAATTTGAAAAGATGAAGAAAGG + Intronic
1067268882 10:44772666-44772688 AGATTTCAACTCCTGGAGAAAGG + Intergenic
1067310977 10:45113331-45113353 AAAATAGAACAGATGGAGACAGG - Intergenic
1067774489 10:49153133-49153155 AGGTTTGAACACCTGTAGAAAGG + Intergenic
1068325544 10:55481324-55481346 AGATCTGAACTGAAGGAGACAGG - Intronic
1069014647 10:63415308-63415330 AGGTTTTATTAGATGGAGAAGGG - Intronic
1069423044 10:68263966-68263988 ACATTTGAGCAGTTGGAGAAAGG + Intergenic
1069536578 10:69257964-69257986 GGATTGGAACAGGTGGAGATGGG + Intronic
1071224863 10:83517111-83517133 AGTTTGGAATAGATGGAAAATGG + Intergenic
1071253512 10:83844776-83844798 AAATGAGAACAGATGGACAAGGG - Intergenic
1071428766 10:85586466-85586488 AGATTAGAAGAAATGGAGAAAGG + Intergenic
1072301673 10:94067875-94067897 AGCTTGGAGCAGGTGGAGAAGGG + Intronic
1072583574 10:96761655-96761677 AGATTTATACATATGGAGCAGGG - Intergenic
1072722048 10:97787160-97787182 AGAGATGGACAGATGGACAAAGG - Intergenic
1073382487 10:103090128-103090150 AAATTGGAAAAGATGGAGAGGGG + Exonic
1075167697 10:120084139-120084161 ACATATGAAAAGATAGAGAATGG - Intergenic
1075961014 10:126567760-126567782 AGACTGGAGCAGGTGGAGAAGGG + Intronic
1076338647 10:129727884-129727906 GGATTTGAACACATGGAGTAAGG + Intronic
1076370907 10:129952853-129952875 ATACTTGAACAGGTGCAGAAAGG + Intronic
1078954659 11:16177964-16177986 AGATAAGCACAGATAGAGAAGGG + Intronic
1079141424 11:17812592-17812614 AGGATTGAACAGGAGGAGAATGG - Intronic
1079385454 11:19975024-19975046 AGAATGAAACAGATGGTGAAAGG - Intronic
1079588763 11:22157060-22157082 AAATCTTAACTGATGGAGAAGGG - Intergenic
1079694839 11:23468438-23468460 AGATTTGACCTAGTGGAGAAAGG - Intergenic
1080191255 11:29552043-29552065 ACATTTGGACATAGGGAGAAGGG + Intergenic
1081626508 11:44659146-44659168 AGAGGTGAACGGATGGATAATGG + Intergenic
1081748151 11:45487524-45487546 AGATTTGCATCGGTGGAGAAAGG + Intergenic
1082768995 11:57191244-57191266 AAATTTGAACAGATCAAGACAGG + Exonic
1083974211 11:66104136-66104158 AGATTTTAATAGATGGTGAATGG + Intronic
1084775934 11:71375527-71375549 AAATTTGCCCAGAAGGAGAAAGG + Intergenic
1086345131 11:85888445-85888467 AGATATGAACAGATGGTTTATGG - Intronic
1086643215 11:89186171-89186193 GGATGTGAGCACATGGAGAATGG + Intronic
1086831429 11:91570073-91570095 AGATTAGAACAAATGGAAAATGG - Intergenic
1087344496 11:96953971-96953993 AAATTTAAACAGTTGGAAAAAGG + Intergenic
1087450258 11:98311745-98311767 AGATTTAAAGAGATTGAGAAGGG - Intergenic
1087671712 11:101114718-101114740 AGATTGGAACCAATTGAGAAGGG - Intronic
1089124854 11:116169685-116169707 AGCTTTGCAGAGATGGAGAGGGG - Intergenic
1089798953 11:121007798-121007820 TCATTTTAACAGAAGGAGAAAGG + Intergenic
1089908787 11:122074453-122074475 AAACTTGGACAGATGGAGATGGG - Intergenic
1090019411 11:123114119-123114141 AGATTCGAACAGAGGCAGAGGGG + Intronic
1090158660 11:124468057-124468079 AGGTGTGATCAGATGAAGAAGGG - Intergenic
1090516394 11:127432753-127432775 AGATTTAAAAAGATTGATAATGG + Intergenic
1091712521 12:2752135-2752157 AGATATGAAAATATGGAGACTGG - Intergenic
1093419098 12:18953984-18954006 AGATTTGAACATATTTAGATTGG - Intergenic
1093887943 12:24485032-24485054 AGGTTCGGACAGATGGAGAAAGG + Intergenic
1094316588 12:29142730-29142752 AGGTTTAAACAAGTGGAGAAAGG - Intergenic
1094395063 12:29996660-29996682 GGATTTCATCAGATGGAGATCGG - Intergenic
1095070205 12:37833449-37833471 AGAGTTGAACATATGTTGAATGG + Intergenic
1095434869 12:42176442-42176464 AGATTGGAAGAGTGGGAGAAGGG - Intronic
1095515540 12:43001049-43001071 ATATTTGAATATATGGGGAAAGG + Intergenic
1095958957 12:47821655-47821677 AGATTTCAACAGAAGGAGAAAGG - Intronic
1096790835 12:54043792-54043814 AGCTTGGAACAGAAGGAGAGGGG - Intronic
1097774925 12:63634307-63634329 AGATATGAAAGGATGGAGAGAGG + Intronic
1097806524 12:63970352-63970374 AGATAAGAACAGATGTAAAAGGG + Intronic
1099138714 12:78942431-78942453 AGAATTGGAAAGATGGAGAGAGG - Intronic
1099303420 12:80925909-80925931 AGAATGGAACAGATGGATAGAGG - Intronic
1099468781 12:83020794-83020816 ACAAGTGAACAGATGTAGAAAGG + Intronic
1099711581 12:86232608-86232630 AAACATGAACAGATTGAGAAGGG + Intronic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100036976 12:90263723-90263745 AGATATGAAAAGATGTAGAAGGG + Intergenic
1100109859 12:91227150-91227172 AGCTTTGCCCAGATGGACAAAGG + Intergenic
1100299794 12:93296548-93296570 AGATTTGGAAAGCTTGAGAAAGG + Intergenic
1100372082 12:93977756-93977778 ACATTTAGACAGATGGAGATGGG + Intergenic
1101483166 12:105122853-105122875 AGGCTTGAAGAGAGGGAGAAAGG - Intronic
1101721929 12:107358004-107358026 AGAGAAGAACAGAAGGAGAAAGG - Intronic
1101841285 12:108329128-108329150 AAATTTGAACATTTGGACAATGG - Intronic
1104370495 12:128219955-128219977 AGAAGTGAAGAGATAGAGAAAGG + Intergenic
1105781999 13:23714055-23714077 GTTTTTGAATAGATGGAGAAGGG - Intergenic
1105803994 13:23938991-23939013 GTTTTTGAATAGATGGAGAAGGG - Intergenic
1106076079 13:26462310-26462332 AGATTGGGGCAGATGGAAAAGGG + Intergenic
1106103312 13:26713062-26713084 AGATTTTAAGAAATGGAGAGTGG + Intergenic
1106750711 13:32763602-32763624 AGATGTGAACAGTTAGGGAAAGG + Intronic
1107078832 13:36352614-36352636 AGATTTGCACAAGTGGAGTAGGG + Intronic
1107697655 13:43016157-43016179 ATATTTAAAAAGGTGGAGAAAGG + Intergenic
1108426432 13:50306364-50306386 TTATCTCAACAGATGGAGAAAGG - Intronic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108839324 13:54593086-54593108 AGATTCCACCAGATGGAGTAGGG - Intergenic
1109616404 13:64838966-64838988 AGATTAGATCAGAGGAAGAATGG - Intergenic
1110972220 13:81778992-81779014 AGAAGTGAACAAATGGAAAATGG - Intergenic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1111986683 13:95073055-95073077 AACTTTAAACAGATGGAGGAAGG + Intronic
1113251238 13:108455377-108455399 AGATTTGAAAGGAAGGAGAGAGG - Intergenic
1113584303 13:111452943-111452965 AGGTTTAAAAGGATGGAGAATGG - Intergenic
1113804446 13:113105234-113105256 AGATGTGGACCGCTGGAGAATGG + Intergenic
1114242889 14:20885241-20885263 AGATTCAAAGAGATGGAGTAAGG + Intergenic
1114249819 14:20949179-20949201 AGATTCAAAGAGATGGAGTAAGG + Intergenic
1114544400 14:23487752-23487774 AGGTATAAAGAGATGGAGAAGGG + Intronic
1114731535 14:24998012-24998034 ATATTTGCACAGATGCACAATGG - Intronic
1115272699 14:31571754-31571776 GGATTTCAAAAGATGAAGAAAGG - Intronic
1117051105 14:51860407-51860429 GGACTTGAACAAAGGGAGAAGGG + Exonic
1117251137 14:53939852-53939874 AGATTTTAAGAGATAGAGAAAGG - Intergenic
1118179392 14:63476542-63476564 ATATTTGAACTGATTGAGCAGGG - Intronic
1118672140 14:68140346-68140368 AGATTTGAACGTTTGGAAAAGGG + Intronic
1120848617 14:89148466-89148488 TGACTTGTACAAATGGAGAAAGG + Intronic
1121851348 14:97223947-97223969 AGATTTGGTCAGATGATGAAGGG - Intergenic
1202840925 14_GL000009v2_random:120423-120445 AGATTTGAAAAGGTGGAACAAGG - Intergenic
1202910308 14_GL000194v1_random:110651-110673 AGATTTGAAAAGGTGGAACAAGG - Intergenic
1202882267 14_KI270722v1_random:71845-71867 AGATTTGAAAAGGTGGAACAAGG + Intergenic
1123786005 15:23674325-23674347 TGATTTGATGAAATGGAGAAGGG - Intergenic
1125324161 15:38519190-38519212 ACCTTTGGACAGATGGAAAAGGG - Intronic
1126012979 15:44320948-44320970 AAATTTAAACAGATGGGAAAGGG - Intronic
1126174962 15:45727709-45727731 AGGATTGAATAGATGGAGCATGG + Intergenic
1126238095 15:46409111-46409133 GGATTTCAACATATGGAGAAAGG - Intergenic
1127690557 15:61391917-61391939 ATTTTTGATGAGATGGAGAAGGG - Intergenic
1127698177 15:61471994-61472016 AGAATTGGCCAGATGAAGAAGGG - Intergenic
1128065618 15:64762818-64762840 AGCTCTGAGCAGATGGAGGATGG - Intronic
1128133158 15:65244075-65244097 AGATCTTACCAGATGGAGAAAGG - Intronic
1129640522 15:77372466-77372488 AGATTCAAACAGATTGAGGATGG - Intronic
1129995798 15:80004040-80004062 GGACTTGACCAGATAGAGAAGGG + Intergenic
1130081267 15:80735657-80735679 AGATTTAAAAACATGAAGAAAGG - Intronic
1130866264 15:87935692-87935714 TGATTTAAAGAGATGGAGAGAGG - Intronic
1133088805 16:3387357-3387379 AGATATAAACAGATAGAGATGGG - Intronic
1134539585 16:15054169-15054191 AGATTTGAAAAGGAGAAGAAGGG - Intronic
1135469990 16:22721741-22721763 AGTGTGGAACAGAGGGAGAAAGG - Intergenic
1137264904 16:46860689-46860711 ATTTTTGTACAAATGGAGAATGG + Intergenic
1138354371 16:56365786-56365808 AGATTAGAACAGAGGGAGAGTGG + Intronic
1138682844 16:58698724-58698746 AGATTTGGACATTTAGAGAATGG + Intergenic
1139173279 16:64657370-64657392 AGATTGGTAAAGATGAAGAAGGG - Intergenic
1139314803 16:66059114-66059136 AGAGATGATCAGCTGGAGAAAGG - Intergenic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1140819632 16:78651052-78651074 ACAGTTGAACAGATGGGCAATGG - Intronic
1141753749 16:85977356-85977378 AGAGTTGATCAGATGCAGAATGG + Intergenic
1143331125 17:6136559-6136581 AGATTTGAATAGTCAGAGAAGGG - Intergenic
1143684681 17:8504347-8504369 AGATAGGACCAGAGGGAGAAGGG - Intronic
1143851738 17:9817969-9817991 TGATTTTAATAGATGGAGATTGG - Intronic
1145374439 17:22334383-22334405 AGATTTGCAAAGATGGAGCCTGG - Intergenic
1146447632 17:32945052-32945074 AGATTTGAACTGGAAGAGAATGG - Intronic
1146625182 17:34430015-34430037 AGAGTTGCTCTGATGGAGAATGG + Intergenic
1148884077 17:50758804-50758826 TGTTTTGAACAGTTGGATAAGGG + Intergenic
1149200084 17:54175374-54175396 AGATTAGAACAGAACAAGAATGG + Intergenic
1149584396 17:57775745-57775767 ATATTTAAAAAGATAGAGAAGGG - Intergenic
1150460593 17:65347018-65347040 TGTTTTGTAGAGATGGAGAATGG + Intergenic
1151250405 17:72829675-72829697 GGATTTTAACAGATGGAAAGGGG - Intronic
1152490159 17:80625886-80625908 AGATTTGCACAGCTGGAGACGGG - Intronic
1153184222 18:2469191-2469213 AGATGGGAACTGATGGACAAAGG - Intergenic
1153374392 18:4358927-4358949 AGAGTTAAACACATGGAGAACGG - Intronic
1155866432 18:30971761-30971783 AATTTTGAAAAGATGGATAAAGG - Intergenic
1156030869 18:32710771-32710793 AGAAATGGACAGATGGAGAGGGG + Intronic
1157745411 18:50130758-50130780 AAATTTGAGCAGATGAAAAATGG - Intronic
1157847428 18:51017137-51017159 AGATTTGTAAAGATGGAGGCAGG + Intronic
1158023846 18:52872418-52872440 AGATTTGCACTGATGGAGCTGGG - Intronic
1158311013 18:56158580-56158602 AGAGAAGAACAGAGGGAGAAAGG + Intergenic
1159037244 18:63289551-63289573 GAATTTGAACAGCTGGATAAAGG + Intronic
1164010531 19:21199757-21199779 GGATTTGAACATATGCAGCATGG + Intergenic
1164677408 19:30110953-30110975 AGATATAAAAAGCTGGAGAAAGG + Intergenic
1166160244 19:40947397-40947419 AGATTCAAATAGATGGAGATAGG + Intergenic
1166169131 19:41015030-41015052 AGATTCAAATAGATGGAGATAGG + Intronic
1167396749 19:49234613-49234635 GGAATTGAGCAGATGGAGAAAGG + Intergenic
1202631388 1_KI270706v1_random:3346-3368 AGATTTGAAAAGGTGGAACAAGG + Intergenic
1202657878 1_KI270708v1_random:40943-40965 AGATTTGAAAAGGTGGAACAAGG + Intergenic
925469709 2:4146507-4146529 TGATTTCAATAGATGCAGAAAGG - Intergenic
925585919 2:5464076-5464098 AGATTTGACCACATAGAGGATGG - Intergenic
925879244 2:8337740-8337762 AGATTTGAGCAGGTGGAAAAGGG + Intergenic
926702793 2:15815023-15815045 ACATTTGCACAGAAGGAAAATGG - Intergenic
927371408 2:22359355-22359377 AGATCTGAACAGATGGGGAATGG + Intergenic
927455345 2:23243915-23243937 ATATTCGAAGACATGGAGAATGG + Intergenic
928130462 2:28645344-28645366 AGCTCTGAAAAGATGGAGAATGG + Intergenic
928455180 2:31414320-31414342 AGATTGGCACAGAATGAGAAAGG - Intronic
929204132 2:39271028-39271050 AGAGCTGAACACATGGGGAAAGG + Intronic
930423618 2:51184995-51185017 AGAGATGAAGAGAAGGAGAAGGG + Intergenic
930605970 2:53493353-53493375 AGACAAGAACAGATGGAGCAGGG + Intergenic
931025408 2:58108616-58108638 AGACTTCCACAGATGGAGACAGG - Intronic
931729671 2:65141813-65141835 AGACTTGAAGAAATAGAGAAAGG - Intergenic
933633480 2:84682191-84682213 GGATCTGAGCAGATGGAGATGGG - Intronic
933884360 2:86704349-86704371 TGATTTGAACAAAAGGAAAAGGG - Intronic
935572028 2:104671679-104671701 ACATTTGCACAGTTGGTGAATGG - Intergenic
935941776 2:108246210-108246232 AGATTGGAACAGAAGAAGACAGG - Intergenic
936144049 2:109967358-109967380 AGATAGGAAGAGATGGAGAAAGG - Intergenic
936180731 2:110265319-110265341 AGATAGGAAGAGATGGAGAAAGG - Intergenic
936200638 2:110404111-110404133 AGATAGGAAGAGATGGAGAAAGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936970804 2:118174881-118174903 AGGTTTGACCTGATGGAGAAAGG + Intergenic
938193307 2:129301912-129301934 AGAGTTGAAATGGTGGAGAAAGG - Intergenic
938206251 2:129426721-129426743 AGAACTGAACAGATGGAGGAAGG - Intergenic
938395620 2:130945536-130945558 AGATCTGAAGAGAGGGAAAAGGG - Intronic
938983393 2:136548250-136548272 AGATTTTAACAGTGGAAGAAGGG - Intergenic
939268187 2:139903038-139903060 AGAGGAGAACAAATGGAGAAGGG + Intergenic
939434614 2:142158727-142158749 AGATTGGGAAAGAGGGAGAAAGG + Intergenic
939547302 2:143569384-143569406 AGAGAAGAACAGATGGAGACGGG + Intronic
939967954 2:148629160-148629182 AGATGTGAACAGGTGGAAATGGG - Intergenic
940101657 2:150046908-150046930 AGATGGGAAAGGATGGAGAAAGG + Intergenic
940329541 2:152459157-152459179 AGATTTGAAAAAATGGAAGATGG + Intronic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
940531526 2:154883914-154883936 AGAATTGAACAGAAGGAAATTGG - Intergenic
943169830 2:184384656-184384678 ATGTGAGAACAGATGGAGAACGG - Intergenic
944595395 2:201256584-201256606 AAATTTGAAGTGTTGGAGAAAGG + Intronic
945282684 2:208050775-208050797 AGATTTGAACAGACCAAGGAAGG + Intergenic
946625389 2:221606610-221606632 ACATTTGAGCAGTTGGAGACAGG + Intergenic
946972131 2:225105820-225105842 AGACTTGAACAGAGGGATGAGGG - Intergenic
947206783 2:227667998-227668020 CGATCTCAAGAGATGGAGAAAGG - Intergenic
947231398 2:227891457-227891479 AGATTAGAAGAGTGGGAGAAAGG - Intronic
948338724 2:237231992-237232014 AGAAGTCAACAGATGGAGGAAGG + Intergenic
1169163699 20:3405252-3405274 TCATTTTCACAGATGGAGAATGG - Intronic
1169997747 20:11577447-11577469 TGATTTTAATAGATGGAAAAGGG - Intergenic
1170368716 20:15625058-15625080 ATATTTAAACAGAAGGAAAAGGG - Intronic
1171332374 20:24351802-24351824 AACATTGAATAGATGGAGAATGG - Intergenic
1172541491 20:35720865-35720887 AGATTTCAACAGACAGAAAAAGG + Intronic
1174288176 20:49486808-49486830 ATAAATGAACTGATGGAGAAAGG - Intergenic
1174532072 20:51222098-51222120 AGAGTTAACCAGATGGAGAAAGG + Intergenic
1174721768 20:52820390-52820412 AGATTTTACCAGGTAGAGAAAGG - Intergenic
1175508255 20:59502976-59502998 AGATTTGGAAAGAGTGAGAAAGG + Intergenic
1176104416 20:63379160-63379182 ATTTTTGAGCAGATGAAGAAAGG - Intergenic
1176349162 21:5777068-5777090 AGACCTGAACTGATGGAGATAGG + Intergenic
1176355976 21:5897652-5897674 AGACCTGAACTGATGGAGATAGG + Intergenic
1176543483 21:8175138-8175160 AGACCTGAACTGATGGAGATAGG + Intergenic
1176562434 21:8358183-8358205 AGACCTGAACTGATGGAGATAGG + Intergenic
1176597768 21:8763282-8763304 AGATTTGAAAAGGTGGAACAAGG + Intergenic
1176629664 21:9125352-9125374 AGATTTGAAAAGGTGGAACAAGG - Intergenic
1176643606 21:9329287-9329309 AGATTTGAAAAGGTGGAACAAGG + Intergenic
1177062351 21:16391650-16391672 AGATTTGAACAAGAAGAGAATGG + Intergenic
1177831728 21:26146617-26146639 AGAATTGAGCAGGTTGAGAAAGG + Intronic
1179625245 21:42645597-42645619 AGCTTTGTACAGAAGGAGCAAGG + Intergenic
1180217516 21:46334992-46335014 AGATTTGAGCTCAGGGAGAAGGG - Intronic
1180369327 22:11969934-11969956 AGATTTGAAAAGGTGGAACAAGG - Intergenic
1180376902 22:12102181-12102203 AGATTTGAAAAGGTGGAACAAGG + Intergenic
1180420671 22:12811514-12811536 AGATTTGAAAAGGTGGAACAAGG - Intergenic
1180720269 22:17902771-17902793 TGATGGGAACACATGGAGAAGGG + Intronic
1181342075 22:22189198-22189220 CGATTTGATCAGCTGGAGAAAGG + Intergenic
1182380814 22:29885336-29885358 AGAATTTAAGAGGTGGAGAAGGG + Intronic
1182403825 22:30106528-30106550 ATATTTGGACAGATTGAGAGGGG + Intronic
1182960778 22:34472939-34472961 AAATTTTAACAGATGGAAATTGG + Intergenic
1183669657 22:39264911-39264933 AGATTTGGTCAGATGGAGGAGGG - Intergenic
1184029420 22:41883086-41883108 AGAGATGAACAGATAGAGGATGG + Intronic
1184371797 22:44087149-44087171 AGATGTGCAGGGATGGAGAATGG + Intronic
1184626462 22:45735488-45735510 AGATGTTAACAACTGGAGAAGGG + Intronic
949456057 3:4240002-4240024 TTATTTCAATAGATGGAGAAAGG - Intronic
949487754 3:4556368-4556390 AGATTTGGACAAATGTATAATGG + Intronic
949917215 3:8974452-8974474 AGATTGGCACAGGAGGAGAATGG - Intergenic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
951437971 3:22687265-22687287 AGAATTGAACTAATGGAGATAGG + Intergenic
951745851 3:25976590-25976612 AGATTTGAACCCAGGGAGACTGG - Intergenic
952539797 3:34356017-34356039 AAATGGAAACAGATGGAGAATGG + Intergenic
953143034 3:40247242-40247264 ACATTTAAACACATGGAAAATGG - Intronic
953143421 3:40250338-40250360 ACATTCCAACAGAGGGAGAAAGG - Intronic
956433647 3:69211975-69211997 AGATTTTAACAAAAGAAGAAAGG + Intronic
956576673 3:70759911-70759933 AGTTTTGAACAAATGATGAAGGG + Intergenic
957240321 3:77652469-77652491 AGATTTGAACAGATTTGTAAAGG - Intergenic
957446019 3:80313858-80313880 AGATTAAAAAAGATGGAGAAGGG + Intergenic
959356304 3:105333960-105333982 AGATTGGAACAGAGGGAGCTAGG + Intergenic
959770873 3:110094169-110094191 AGGTTTGAACAAATGTATAATGG + Intergenic
960397703 3:117157146-117157168 AGGTGTAAATAGATGGAGAAAGG + Intergenic
961207941 3:125102215-125102237 AGAGTTTTCCAGATGGAGAAGGG + Intronic
961661633 3:128471766-128471788 AGATTTAAACAAGGGGAGAATGG + Intergenic
961905836 3:130262149-130262171 AGGTTTAACCAGATGCAGAAGGG - Intergenic
961959789 3:130843100-130843122 ATATTAGAAAACATGGAGAAAGG + Intergenic
962511293 3:136103274-136103296 AGATCTGAAGAGGTGCAGAATGG + Exonic
964035991 3:152196885-152196907 AGATTAGAAAAAAAGGAGAAGGG - Intergenic
964096455 3:152936932-152936954 AGACTTGAACTGCTGGAGTAGGG - Intergenic
964485668 3:157183148-157183170 AGAAGTGACCAGAAGGAGAAGGG - Intergenic
964761622 3:160139919-160139941 AGCTCTGCACAGATGCAGAAAGG - Intergenic
966669382 3:182509663-182509685 AGATTTGAACAGAAAAAGAAGGG + Intergenic
966760076 3:183410152-183410174 AGATTTAGATAGATGGAGAGGGG - Intronic
967330971 3:188288947-188288969 AGATTTTAAAATATGGAGATTGG + Intronic
967952382 3:194851294-194851316 AGATTTGGACAAGTGGAGAGAGG + Intergenic
1202743276 3_GL000221v1_random:75742-75764 AGATTTGAAAAGGTGGAACAAGG - Intergenic
970642508 4:18082770-18082792 AAATCTCAACAGATGGAGACAGG - Intergenic
971060185 4:22959326-22959348 AGATTAGAAAAGATGGTGCATGG - Intergenic
971155705 4:24080188-24080210 AGATTTGGATACATGGAGATAGG - Intergenic
971271068 4:25146347-25146369 AGATTTGAACAGTTGTATAATGG - Intronic
972259789 4:37396513-37396535 GGATTTGAAAATATGGAGACTGG - Intronic
973127616 4:46607202-46607224 AGATTTGAAAAGAAAGATAAGGG - Intergenic
973361069 4:49165536-49165558 AGATTTGAAAAGGTGGAACAAGG + Intergenic
973930376 4:55787388-55787410 AGAGTGGGAGAGATGGAGAAAGG + Intergenic
974977222 4:68905944-68905966 AGATTGGAACATATGGAGGAGGG + Intergenic
974988463 4:69058226-69058248 AGATTGGAGCATATGGAGGAAGG - Intronic
975208569 4:71672425-71672447 AGATCTGAAGAAAGGGAGAAGGG + Intergenic
975692757 4:76982191-76982213 AGATTTGAATAGTTGCAGAAAGG - Intronic
975947014 4:79719280-79719302 AGAATTGAAGAGTTGGAGATTGG + Intergenic
976946529 4:90776774-90776796 AGATTTGAGCAATTTGAGAAAGG + Intronic
977573742 4:98656519-98656541 ACATTTTCACAAATGGAGAAGGG + Intronic
977861586 4:101967472-101967494 AGATTTAAACAAATTGAGAAAGG + Intronic
977938614 4:102834004-102834026 AGCTTTGAAAAGTTGGAGAATGG + Intronic
977940296 4:102850410-102850432 ATATTTGAATTGATGGAGAGGGG - Intronic
978066779 4:104414461-104414483 ATATTTGAACAAAAGGAGCAAGG + Intergenic
978804641 4:112787504-112787526 AGAATTGATGAGAGGGAGAAAGG - Intergenic
978977576 4:114897144-114897166 AGATTTAGACAGATGTATAATGG + Intronic
979045833 4:115862087-115862109 GAATTTTAAAAGATGGAGAAAGG + Intergenic
979151408 4:117320832-117320854 AGATTTCAACATATGAATAAGGG - Intergenic
979350608 4:119640530-119640552 GTATTTGAACAGATGGAGAAAGG - Intergenic
979441313 4:120752723-120752745 AGATTTGAACCTAGGGAGACTGG - Intronic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
980228242 4:130014870-130014892 AGATTTTAACAGATTAAAAATGG + Intergenic
980740021 4:136938380-136938402 AGAGGTGAAAAAATGGAGAAAGG + Intergenic
980887364 4:138777851-138777873 AGATTTGAGCAGAAGGACAGAGG + Intergenic
982063522 4:151628599-151628621 AGATTTTAAAAAATGGAAAAGGG + Intronic
982207097 4:153004934-153004956 AGATTTCAACATAGGGAGGAGGG - Intergenic
982338739 4:154270939-154270961 AGATTTGTTCAGATAGAGCAGGG + Intronic
982356876 4:154480366-154480388 AGCTTTGAAAAGTTGGAGGACGG + Intronic
982357344 4:154485436-154485458 AGGTCAGAACACATGGAGAAGGG + Intronic
982619112 4:157680607-157680629 AGATTTTGACAGATGGAAATTGG + Intergenic
983357577 4:166683215-166683237 AGTGTGGAACAGGTGGAGAATGG - Intergenic
984292645 4:177814688-177814710 GGATTTGTACAGATGTATAATGG + Intronic
984576213 4:181451492-181451514 AGAATAGAACAGATGTAGAAAGG + Intergenic
1202758500 4_GL000008v2_random:87613-87635 AGATTTGAAAAGGTGGAACAAGG + Intergenic
985639884 5:1058650-1058672 AGATTGGCACAGATGGGGGAGGG + Intronic
985831392 5:2235354-2235376 AGATCAAAACAGATGAAGAAGGG - Intergenic
986075477 5:4332687-4332709 AGTTATGAACAGAAGGAAAATGG + Intergenic
986325189 5:6667519-6667541 TAATTTGACAAGATGGAGAAAGG - Intronic
986467553 5:8041363-8041385 TGAGTTGAACAGATGAAGAGTGG - Intergenic
986611448 5:9571989-9572011 CCATTTGTACAGATGAAGAATGG - Intergenic
988376856 5:30447397-30447419 ATATTAGAACAGATGGATCAAGG + Intergenic
989619885 5:43373689-43373711 AGATTATAAAAGATGAAGAAAGG - Intergenic
990373379 5:55144014-55144036 AGATTTGCACATTTGAAGAATGG + Intronic
990565743 5:57026771-57026793 AGTTTTGAAGAGATTGAAAATGG + Intergenic
992094719 5:73352342-73352364 AGATTTGAGCTGCTTGAGAATGG + Intergenic
992332934 5:75736330-75736352 AGAAGTGAACAAAAGGAGAAAGG + Intergenic
992818877 5:80473668-80473690 AGATTTGAACAAATGGAATGAGG - Intronic
992872491 5:81021112-81021134 AGAAATGAAAACATGGAGAATGG + Intronic
993337144 5:86674336-86674358 ACATTTGAACTTATGGAGACAGG + Intergenic
993504093 5:88690792-88690814 AGCCTTGAAGAGCTGGAGAACGG + Intergenic
993624301 5:90205720-90205742 AGATTTGAACAGACAGAAAAAGG + Intergenic
993787318 5:92159269-92159291 AGATCTGAGGAGATGGAGAGTGG - Intergenic
993869831 5:93239688-93239710 AGATTGGAATAGATTGGGAAGGG - Intergenic
994012500 5:94922214-94922236 AGAGTTCAAGAGATTGAGAAAGG + Intronic
994171019 5:96660197-96660219 AGGTGTGAACAGAAGGAGAAGGG - Intronic
994202341 5:96991920-96991942 AGATCTCAACAGGTGGAAAATGG - Intronic
994447294 5:99893841-99893863 AGATTTGAAGAGGATGAGAATGG - Intergenic
995616584 5:113971254-113971276 AGATTTCATCAGATGAAGAAAGG - Intergenic
996419624 5:123248051-123248073 ACATTTAAACAGATGAGGAAAGG + Intergenic
996525353 5:124473531-124473553 AGATTTAAACAGATAGGGATGGG - Intergenic
996672453 5:126134559-126134581 AGATTTGAAGAGTTTGAGGAAGG - Intergenic
996984168 5:129537997-129538019 AGATTTGCATGGATGGAGAGGGG + Intronic
997146832 5:131443562-131443584 AGGTTTGTGCAGAAGGAGAAGGG - Intronic
999528584 5:152436322-152436344 AGAATTGAAAACAGGGAGAAAGG - Intergenic
999915830 5:156258582-156258604 AGATGTGACCACATAGAGAAAGG - Intronic
999998948 5:157119662-157119684 AGATTTGACCAGATGTCAAAGGG + Intronic
1000173879 5:158730714-158730736 AGATTTGAACCTATGCAGCATGG - Intronic
1000662479 5:163952603-163952625 GGATTTCAACACATGGAGACAGG + Intergenic
1001273734 5:170335162-170335184 AGATTTGAAGAGATGGGCAGAGG + Intergenic
1001931417 5:175675776-175675798 AGAGTTTGACAGGTGGAGAATGG - Intronic
1002597389 5:180333191-180333213 AGATATAAAAAAATGGAGAAGGG - Intronic
1002837051 6:873892-873914 AGTTTTGACCAGAGGGAAAAAGG - Intergenic
1003626212 6:7744017-7744039 AAATTTCAACATATGGAAAAAGG + Intronic
1003731748 6:8832309-8832331 AGATTTGGACAAATGTAGAATGG + Intergenic
1005149695 6:22734596-22734618 AGTTTTTAAGTGATGGAGAATGG + Intergenic
1005600400 6:27421169-27421191 AGATTTGAACAAATGTATAGTGG - Intergenic
1006508849 6:34510616-34510638 AGATCTAAAAAGAGGGAGAAAGG - Intronic
1007913404 6:45538053-45538075 AGAAGTGGACAAATGGAGAAGGG - Intronic
1008081402 6:47198545-47198567 AGATTTGAACAAGTGGAGATTGG - Intergenic
1008273857 6:49520672-49520694 GGATTTGGAAAGGTGGAGAAAGG + Intronic
1008679345 6:53855904-53855926 AGTTTTGAACAATTGGAGCATGG + Intronic
1008795617 6:55299132-55299154 AGAATTGAACAGCAGGAAAAGGG + Intergenic
1009332707 6:62443796-62443818 AGATTTAAAAAGATAAAGAAGGG - Intergenic
1009405725 6:63310087-63310109 AGTTTTGTACAGATGGAGATAGG - Intronic
1009564188 6:65290215-65290237 AGTTTAGTAAAGATGGAGAAAGG + Intronic
1009815533 6:68728980-68729002 AGATTTTAACAAGTGGAAAAAGG - Intronic
1010071152 6:71747705-71747727 AGAATAGGAAAGATGGAGAAAGG - Intergenic
1010524295 6:76881326-76881348 ATATTTGAACACCTGGTGAATGG - Intergenic
1010648032 6:78417147-78417169 AGATTTGAGGAGAAAGAGAAAGG + Intergenic
1010760553 6:79717595-79717617 AGATTTTCACAGAAGGAAAACGG + Intergenic
1010838483 6:80618476-80618498 AGATTTAAAAAGATCAAGAATGG - Intergenic
1011059787 6:83251639-83251661 AGATTTGAAGAGGGGAAGAAAGG + Intronic
1011538447 6:88403818-88403840 GAAATTAAACAGATGGAGAAGGG - Intergenic
1012862150 6:104572800-104572822 AAATATGAACATATTGAGAAAGG + Intergenic
1013624261 6:111921113-111921135 AGACTTGAAAAGAAGGAGAGAGG - Intergenic
1014901686 6:126973315-126973337 AGGTTTTAAGAAATGGAGAATGG + Intergenic
1014909718 6:127077100-127077122 ATAGTTGATCAGAAGGAGAAGGG + Intergenic
1015691771 6:135932508-135932530 TAATCTGAACATATGGAGAAGGG + Intronic
1016050079 6:139521705-139521727 AGATTGGAAAAGGTGGAGGAAGG + Intergenic
1016242477 6:141946948-141946970 GGATTTTAACAGATTCAGAAGGG + Intergenic
1016615037 6:146037950-146037972 AGAGTTGCTCAGATGCAGAAGGG - Intronic
1016959032 6:149653963-149653985 AGAATTGAACAGATGAAGTGTGG + Intergenic
1017946462 6:159100183-159100205 ACATTTGATCATGTGGAGAAGGG - Intergenic
1018724045 6:166597030-166597052 TCATGGGAACAGATGGAGAAAGG + Intronic
1018888348 6:167961496-167961518 AGATGTGAGCAGAAGGATAAAGG + Intronic
1021913589 7:25409984-25410006 GAATCTGAACAGATGCAGAAGGG + Intergenic
1022477161 7:30719021-30719043 AGAATTGAACAAATGTATAATGG + Intronic
1022647755 7:32247142-32247164 GGATTTTAACAAATGAAGAAAGG + Intronic
1022861771 7:34375096-34375118 AGATTGGATATGATGGAGAAGGG - Intergenic
1023121000 7:36908297-36908319 AAATTTGAAAAGAAGGAAAATGG - Intronic
1023620175 7:42063617-42063639 AGATGTTAAAAGATGGAAAAAGG + Intronic
1023726901 7:43151794-43151816 TAATTGGAACAGATGGAGAAGGG + Intronic
1024476476 7:49817193-49817215 AGCTTTTAACAGATGAATAATGG - Intronic
1024810726 7:53208529-53208551 AGATCTGAACAGAAAGAAAAAGG + Intergenic
1025614091 7:63103213-63103235 AGAGATGTACAGATGGTGAAAGG - Intergenic
1026545200 7:71316283-71316305 GGATCTGATCAGAGGGAGAATGG + Intronic
1027822417 7:83063757-83063779 AAATTTGAATAGATACAGAATGG - Intronic
1028122155 7:87068458-87068480 TGATTTCAACAAATGGAAAATGG + Intergenic
1030183247 7:106732498-106732520 AGATTTGACAATAGGGAGAAAGG - Intergenic
1030757186 7:113301320-113301342 AGGGTTGAACAGATGAAGCACGG - Intergenic
1031523320 7:122793384-122793406 AGATTTAAAAAGATAAAGAAGGG - Intronic
1032102829 7:128997359-128997381 AGATTTGAAGAGGTAGAGAAGGG + Intronic
1032647052 7:133836396-133836418 AGAATTGGCCAGAAGGAGAAGGG - Intronic
1032991128 7:137396048-137396070 ACATTTGAGCAGAGCGAGAAAGG + Intronic
1033024932 7:137762927-137762949 AGATATGAATAGCTGGACAATGG - Intronic
1033101592 7:138477898-138477920 ATATTTGAACATATTGAAAAGGG + Intronic
1033229344 7:139584253-139584275 ACATGTGAAGACATGGAGAAGGG + Intronic
1033305963 7:140225937-140225959 AGATATGCACACAGGGAGAATGG - Intergenic
1033462232 7:141557368-141557390 ATATTTTAACAAATGGAGCATGG + Intronic
1033583760 7:142759433-142759455 AGATTTGAGCACATGGTAAATGG - Intronic
1034378389 7:150666654-150666676 ACATTTGTACAGATGGAGCCAGG + Intergenic
1035137253 7:156716239-156716261 AGATTTGGATAGATAGAGAAAGG + Intronic
1036002160 8:4618400-4618422 AGATTTGAACAGAAGAGCAAAGG + Intronic
1036584325 8:10109002-10109024 TGTACTGAACAGATGGAGAAGGG + Intronic
1037272885 8:17149057-17149079 AAATTTGAGCAAATAGAGAAAGG + Intergenic
1039653432 8:39371081-39371103 AGCTCTGAACAGATCGATAATGG + Intergenic
1042531192 8:69817725-69817747 AGACTTGATCATACGGAGAAGGG - Intronic
1045429840 8:102103247-102103269 GGATTTGAACAGGCAGAGAAAGG - Intronic
1045645578 8:104293887-104293909 GGATTTGGAGAGATGGAAAATGG - Intergenic
1046057034 8:109091102-109091124 AGATTTGAAGAGAGAGAGATTGG + Intronic
1047708392 8:127525368-127525390 AGCTGAGAACAGGTGGAGAAGGG - Intergenic
1048525270 8:135196669-135196691 AAATTTGCACAGATAGAAAAAGG - Intergenic
1048829657 8:138463832-138463854 AGATTTGAAGATATAAAGAAAGG + Intronic
1051595801 9:18823527-18823549 AGGGTGGAACAGAGGGAGAAGGG - Intronic
1052000198 9:23269476-23269498 AGATTCCAACATATGGATAAGGG + Intergenic
1052529588 9:29664335-29664357 AGATTTGAACAGGTGGAGAAAGG + Intergenic
1052542933 9:29834625-29834647 AGAATTCAACAGATAAAGAAGGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054750400 9:68899104-68899126 AGATTAGAAGAGCTGGAGAGTGG - Intronic
1055473678 9:76639867-76639889 AGCTTTCAAAAGATGGGGAATGG - Intronic
1056117176 9:83452026-83452048 AGATGTCAACAGAGGGAGACTGG + Intronic
1056296409 9:85197786-85197808 AGATTTTAACAGCTGGGAAAAGG - Intergenic
1058234643 9:102474772-102474794 AAATTTGAACAGATAGGAAAGGG - Intergenic
1059502823 9:114769934-114769956 ACTTTTGCACAAATGGAGAAGGG + Intergenic
1059650393 9:116310678-116310700 AGATTTGAACAGATATTGAAAGG - Intronic
1060591722 9:124821046-124821068 AGATCTGCACAGATGGTGAGGGG - Intergenic
1062238931 9:135525763-135525785 AGATTGGAGCGGATGGAGCAGGG - Intronic
1203690110 Un_GL000214v1:34628-34650 AGATTTGAAAAGGTGGAACAAGG + Intergenic
1203752499 Un_GL000218v1:93033-93055 AGATTTGAAAAGGTGGAACAAGG - Intergenic
1203711912 Un_KI270742v1:105705-105727 AGATTTGAAAAGGTGGAACAAGG - Intergenic
1203539287 Un_KI270743v1:72486-72508 AGATTTGAAAAGGTGGAACAAGG + Intergenic
1203555523 Un_KI270743v1:204038-204060 AGATTTGAAAAGGTGGAACAAGG - Intergenic
1203646165 Un_KI270751v1:69425-69447 AGATTTGAAAAGGTGGAACAAGG - Intergenic
1186203127 X:7174209-7174231 ATATTTGAGAAGTTGGAGAAGGG + Intergenic
1186500961 X:10050219-10050241 AGACTGGATCAGAGGGAGAATGG - Intronic
1186890728 X:13956933-13956955 AGATTTTATCAGAAGGAAAAAGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188627073 X:32298096-32298118 GGTTTTGAACAGAAGCAGAAAGG + Intronic
1189214943 X:39314849-39314871 AGGAGTGGACAGATGGAGAAAGG - Intergenic
1190282279 X:48938973-48938995 AGATGGGAACAGAGGTAGAATGG - Intronic
1191139417 X:57100548-57100570 AAATGTGAACACATGGACAAAGG + Intergenic
1191872362 X:65759067-65759089 AAATTGGAACAGATGGTGAGGGG + Intergenic
1192053538 X:67748408-67748430 AGATTCTAACAGAGGGAGAAAGG - Intergenic
1193430543 X:81398050-81398072 CGATTCGAGCAAATGGAGAATGG + Intergenic
1193586956 X:83334648-83334670 AGATTTGAAAAGAAGAATAAGGG - Intergenic
1193823869 X:86198423-86198445 AGAGCTGAACAGAAGGAGATTGG + Intronic
1194272384 X:91832666-91832688 AGAGTAGAACAGATTTAGAATGG + Intronic
1194698742 X:97088338-97088360 AGAAATGAGCAGATGAAGAATGG - Intronic
1195395954 X:104410838-104410860 AGATTAGAACAAAGAGAGAAAGG - Intergenic
1196046442 X:111260761-111260783 AGATTGGAATGGTTGGAGAAGGG - Intronic
1196093789 X:111776569-111776591 AGATATTCTCAGATGGAGAAAGG - Exonic
1196695969 X:118612097-118612119 AGAAATGAAGAGAGGGAGAATGG - Intronic
1197402012 X:126004759-126004781 ACAATTGAACATATGGAGATAGG - Intergenic
1198498380 X:137217028-137217050 AGATTTGAACAAGTTGTGAAAGG + Intergenic
1198990218 X:142505177-142505199 TGAGTTTAACAGCTGGAGAAGGG - Intergenic
1199323198 X:146465490-146465512 AGTTTTGAACAGTTTGAGTAGGG - Intergenic
1199589087 X:149449462-149449484 AGAGTTGAACTGAAGGAGATAGG - Intergenic
1200037410 X:153341070-153341092 AAAAGTAAACAGATGGAGAATGG - Intronic
1200406816 Y:2820331-2820353 AGAATTGAACTCATGGAGATGGG - Intergenic
1200589629 Y:5054088-5054110 AGAGTAGAACAGATTTAGAATGG + Intronic
1201066179 Y:10096970-10096992 AAATTTTAACAGATGTACAAAGG - Intergenic
1201166148 Y:11210645-11210667 AGATTTGAAAAGGTGGAACAAGG - Intergenic
1201177340 Y:11316837-11316859 AGAATTTCACAGATGGACAAGGG - Intergenic
1201893073 Y:18963756-18963778 CAATTAGAACAGATGGACAAAGG + Intergenic