ID: 950816883

View in Genome Browser
Species Human (GRCh38)
Location 3:15713641-15713663
Sequence GACAGTAAGTCCTATATTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950816883_950816885 3 Left 950816883 3:15713641-15713663 CCTGCAATATAGGACTTACTGTC 0: 1
1: 0
2: 0
3: 2
4: 100
Right 950816885 3:15713667-15713689 CACTGGACCATATAAAGATCAGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950816883 Original CRISPR GACAGTAAGTCCTATATTGC AGG (reversed) Exonic
905017753 1:34789192-34789214 CACAGCAAGTCCTACATTGAAGG + Intronic
905888293 1:41503441-41503463 GACAGTAACTCTCATCTTGCTGG + Intergenic
905967390 1:42110469-42110491 TACAGTAAGTTCTGTAATGCTGG - Intergenic
908499980 1:64733478-64733500 GACAGCTATTCCAATATTGCTGG + Intergenic
909981793 1:82111574-82111596 GACAGTAAGACCTATTTTAATGG - Intergenic
912468263 1:109888891-109888913 CACAGTAAGTCCAATATTTAGGG + Intergenic
915969638 1:160345057-160345079 AACAGTAAGACCTATTTTGTGGG - Intronic
918810235 1:189108638-189108660 GATAATAAGTTTTATATTGCAGG + Intergenic
1067139552 10:43645453-43645475 GACAATAAGTTCTATCTTGTAGG - Intronic
1068576708 10:58691849-58691871 GAAAGTAAGTCCTAAATCACTGG - Intronic
1077695180 11:4387009-4387031 GAAAGTAAGTTCTGGATTGCTGG + Intronic
1078101112 11:8330873-8330895 GACAGTAATTCCTACCCTGCAGG + Intergenic
1078728188 11:13951362-13951384 GTAAGTAATTCCTATATTTCAGG + Intergenic
1078955918 11:16194890-16194912 GACAGTCTGTCTTATATTGAAGG - Intronic
1079175550 11:18137097-18137119 GACAGTAAATCCCACATGGCAGG + Intronic
1079179115 11:18173151-18173173 GACAGTAAATCCCATACGGCAGG + Exonic
1079263911 11:18911480-18911502 GACAGTAAATCCCACATGGCAGG - Intergenic
1081019472 11:37926962-37926984 GACACTAAGTCATATACTCCTGG + Intergenic
1081069516 11:38594096-38594118 GAAAGCAACTTCTATATTGCTGG + Intergenic
1081453501 11:43197107-43197129 AACAGAAATTCCTATATTGTAGG - Intergenic
1082198971 11:49340035-49340057 GAGAGGAAGTTTTATATTGCTGG + Intergenic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1085905454 11:80755788-80755810 GAAAATAATACCTATATTGCAGG - Intergenic
1086051045 11:82590777-82590799 TACACCAAGTCCTATATTTCTGG - Intergenic
1086656841 11:89368052-89368074 GACAGGAAGTTTTATATTGCTGG - Intronic
1089210078 11:116794147-116794169 GATAGTAAGTGCTATAATCCAGG - Intergenic
1089770298 11:120797641-120797663 GACAGTGATTCCTATCTGGCTGG - Intronic
1090864722 11:130689436-130689458 CACAGGAAGTCCTATATCCCTGG - Intronic
1097494869 12:60318375-60318397 GACAGTATGTCTTACACTGCTGG + Intergenic
1109052484 13:57501934-57501956 GCCAGTAAGACATAAATTGCAGG - Intergenic
1114814546 14:25941983-25942005 CACAGTTAGACCTATATTTCTGG - Intergenic
1118070529 14:62242272-62242294 GACAGGAAGTCCTGAATTCCAGG - Intergenic
1118854981 14:69613737-69613759 GACAGGAAGTCCTATCTATCAGG - Intronic
1120521475 14:85531668-85531690 GACAGTGAGTGCCATCTTGCTGG - Intronic
1127397824 15:58557177-58557199 GCTAGTAAGTCGTATATGGCTGG - Intronic
1129373192 15:75110607-75110629 AACAGTGAGTTCTATATAGCAGG + Intronic
1129617639 15:77112169-77112191 TCCTGTGAGTCCTATATTGCTGG + Exonic
1129765375 15:78162205-78162227 GACAGGAAGTCCCACCTTGCTGG - Intronic
1132867012 16:2098088-2098110 GACAGAATGTCCTAGAATGCTGG + Intronic
1134548144 16:15125911-15125933 GACAGAATGTCCTAGAATGCTGG + Intronic
1135097125 16:19573890-19573912 CTCAGTAAGTCCCATATAGCTGG + Intronic
1139539815 16:67606450-67606472 GACAGTAACTCCTAGAATGTAGG + Intronic
1147059540 17:37864055-37864077 GACACTAAGTCTTAAATTCCTGG - Intergenic
1150364539 17:64569716-64569738 AACAGGAACTCATATATTGCCGG + Intronic
1153895262 18:9553168-9553190 GACAGTAAGACACATATTACAGG + Intronic
1157249960 18:46086257-46086279 TACAGTAATTTCTGTATTGCAGG - Exonic
1159128993 18:64258444-64258466 GGCCGAAAGTCCTAAATTGCAGG + Intergenic
1160546006 18:79656195-79656217 GAAAGTAACTCCTTTGTTGCTGG + Intergenic
1163195769 19:15718563-15718585 AACAGGAAGTTCTTTATTGCAGG - Intergenic
1164774187 19:30838931-30838953 AACAGAAAATCCTATATTCCAGG + Intergenic
1167854508 19:52226793-52226815 TACAGTAATACCTAGATTGCAGG + Exonic
925732015 2:6925981-6926003 GTTAGTAAGTGCTATGTTGCTGG - Intronic
926311922 2:11681445-11681467 GCCAGCACGTCCTATATGGCCGG - Intronic
939528407 2:143325668-143325690 GACATTAAGTCCTTTATTTGGGG + Intronic
1173424224 20:42928700-42928722 GACAATAACTCCTATGTTCCAGG + Intronic
1175019607 20:55830300-55830322 GACAGTAAAATCTTTATTGCTGG - Intergenic
1178895079 21:36551149-36551171 AACAGGAAGTCCGAAATTGCGGG - Intronic
1181785796 22:25225709-25225731 GCCAGTAAGTCAGATATGGCTGG + Intronic
1183961088 22:41412433-41412455 GACAATAAGGCCCATTTTGCAGG + Intergenic
950816883 3:15713641-15713663 GACAGTAAGTCCTATATTGCAGG - Exonic
960908427 3:122624404-122624426 CACAGAAAGTCCCATGTTGCAGG + Intronic
966470305 3:180281839-180281861 GACAGCAAGTCCTCTCTTGAAGG - Intergenic
967794154 3:193580283-193580305 GACAGTAAGTCCCATTGTCCTGG + Intronic
970126616 4:12820241-12820263 TACAGTAAGTTATATAGTGCTGG - Intergenic
971452229 4:26810791-26810813 GACAGTAAGTTCCAGAATGCAGG + Intergenic
971612264 4:28740744-28740766 AACACTAAGTCCTTTATTCCTGG - Intergenic
974529595 4:63090559-63090581 GACATAAAGTCTCATATTGCAGG - Intergenic
980993831 4:139761940-139761962 GACAAGCAGTTCTATATTGCTGG + Intronic
984609983 4:181827039-181827061 GACAGGGAGTCCTATAAAGCAGG + Intergenic
987239339 5:15978061-15978083 GACAGTATTTCCGATTTTGCAGG + Intergenic
990810567 5:59717771-59717793 TACAGTAAGTGCTCTATTGTTGG - Intronic
994394228 5:99215230-99215252 GATATTACTTCCTATATTGCAGG - Intergenic
994750635 5:103733250-103733272 GGCAGTAAGTCCTTTCTTGAAGG + Intergenic
995156542 5:108920940-108920962 GACAGTAAGACCTCAATGGCTGG - Intronic
996762654 5:127001816-127001838 GCCAGTAAGTCCTTGAGTGCTGG + Intronic
1001522275 5:172403209-172403231 GACTGTAATTCCTATTTTTCAGG + Intronic
1008219582 6:48839175-48839197 GCCAGAAAGTCCTATTTTGGGGG - Intergenic
1009365589 6:62855499-62855521 GACATTACTTCCAATATTGCAGG + Intergenic
1009846186 6:69138151-69138173 CACAGTAAGCCATATATTCCAGG - Intronic
1023587816 7:41749573-41749595 GACAAAAAGTCCAATATTTCTGG + Intergenic
1023715885 7:43043487-43043509 GACAGCAATTCCTATCTTGTAGG - Intergenic
1026264435 7:68783871-68783893 GAAAGTGAGTCATTTATTGCAGG - Intergenic
1027341280 7:77210802-77210824 GCCAGCATGTCCTATATGGCTGG + Intronic
1032059271 7:128710318-128710340 AACAGAATGTACTATATTGCAGG - Intronic
1038794854 8:30700888-30700910 GATAGCAGGTCCTATCTTGCAGG + Intronic
1043635078 8:82375148-82375170 GATAGTAAGACCAATATTACGGG - Intergenic
1046798963 8:118403932-118403954 GACACTGAGACTTATATTGCTGG - Intronic
1055128714 9:72750139-72750161 GACAGTAACACCTCTATTTCTGG - Intronic
1056607877 9:88102057-88102079 GACAGTAAGTGCTAGTTAGCGGG + Intergenic
1058518851 9:105800202-105800224 GACATTACTTCCAATATTGCAGG - Intergenic
1058521529 9:105817918-105817940 GACATTACGTCCAATATTGCAGG + Intergenic
1186705140 X:12133055-12133077 GACAGTAAGTGCTAGATTAAGGG + Intergenic
1188903622 X:35764437-35764459 GGCAGCAAGTCCTATTTTGAAGG - Intergenic
1190906077 X:54729783-54729805 GAGAATCAGTCCTATTTTGCAGG - Intergenic
1193882933 X:86947635-86947657 GCCAGCAAGTCCTACATGGCTGG + Intergenic
1195444627 X:104937942-104937964 GATAGTAAATCCTAAATTACAGG + Intronic
1195872543 X:109501184-109501206 GAAAGTAAGGCATTTATTGCAGG + Intergenic
1197060372 X:122172224-122172246 GACATAAAGTACTATATTGTGGG - Intergenic
1198882898 X:141300505-141300527 GACAGAAATACCTATATTGTTGG - Intergenic
1202163968 Y:21967436-21967458 GACAGGCAGTCATATATTGTAGG - Intergenic
1202227388 Y:22618928-22618950 GACAGGCAGTCATATATTGTAGG + Intergenic
1202315735 Y:23576726-23576748 GACAGGCAGTCATATATTGTAGG - Intergenic
1202555031 Y:26093348-26093370 GACAGGCAGTCATATATTGTAGG + Intergenic