ID: 950820772

View in Genome Browser
Species Human (GRCh38)
Location 3:15756086-15756108
Sequence TGGTATGCATAGATTTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950820772_950820777 3 Left 950820772 3:15756086-15756108 CCCCCACAAATCTATGCATACCA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 950820777 3:15756112-15756134 GAACTTTCCCTTCAGATAAACGG 0: 1
1: 0
2: 0
3: 20
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950820772 Original CRISPR TGGTATGCATAGATTTGTGG GGG (reversed) Intronic
901606706 1:10464796-10464818 TGGTATGCAGAGAGTGATGGAGG - Intronic
902168040 1:14588363-14588385 AGGCATACATAGATTTGTGAAGG + Intergenic
904671592 1:32170115-32170137 TGGTATACATATGTTGGTGGTGG + Intronic
905076675 1:35278101-35278123 TGGTATTCCTTGACTTGTGGCGG + Intronic
906637475 1:47418859-47418881 TAGTATGCATAGTATTCTGGAGG + Intergenic
907812126 1:57881703-57881725 TCGTATAAATAGATGTGTGGGGG + Intronic
909326198 1:74353418-74353440 TGGTATGCAAAGGGATGTGGGGG + Intronic
910352418 1:86313453-86313475 GGGTATGCTTTTATTTGTGGAGG + Intergenic
916004596 1:160647827-160647849 GGGTATGCATATATTTGTATGGG + Intergenic
921196210 1:212760247-212760269 TGGTGTGCCTAAAGTTGTGGTGG - Intronic
922366140 1:224865519-224865541 TGGTATGAAAATATTTATGGTGG - Intergenic
923042406 1:230328549-230328571 TGTCATGCACAGATTCGTGGTGG + Intronic
923327748 1:232895918-232895940 TGTTATACATATATTTTTGGAGG - Intergenic
923700267 1:236293576-236293598 TAGTATGCATACATTTTGGGGGG - Intergenic
924333457 1:242963881-242963903 TAGTTAGCATAGATTTGTGTGGG + Intergenic
1065472342 10:26095181-26095203 TGGCATCCAAAGCTTTGTGGTGG + Intronic
1070595178 10:77827873-77827895 AGGTATATATAGATTTGTAGGGG + Intronic
1071755952 10:88539585-88539607 TGCTATGGATAAATATGTGGTGG - Intronic
1072931049 10:99662698-99662720 TGGTATTCATTGATTTATTGAGG + Intronic
1074804871 10:117039033-117039055 TGGTATACATATATTTGTGCAGG - Intronic
1078868437 11:15321106-15321128 TTGTAGTCATAGATTTCTGGAGG - Intergenic
1081218330 11:40429837-40429859 TGATGTGCATAGATTTTTGAAGG + Intronic
1081235776 11:40645738-40645760 TGGGATGCAGAATTTTGTGGGGG - Intronic
1086775554 11:90828143-90828165 TGTGATGCATAGATTTTTGTTGG - Intergenic
1087242310 11:95792696-95792718 TGTTATACTTTGATTTGTGGAGG - Intronic
1091997669 12:5007368-5007390 TGGTATGCATATGTATGTGTGGG + Intergenic
1093360547 12:18221376-18221398 TTTTATGCATATATTAGTGGGGG + Intronic
1094444758 12:30517728-30517750 TGGTATGCAAAGCATTGTAGAGG - Intergenic
1097395023 12:59062673-59062695 TGAAATACAAAGATTTGTGGCGG + Intergenic
1101547035 12:105724109-105724131 TCTTATGCATACATTTGTGGAGG - Intergenic
1106532610 13:30607979-30608001 TGGTATTCATACCTTTGTGTAGG + Intronic
1107691702 13:42960074-42960096 TGGTATCCATTGTGTTGTGGGGG + Intronic
1107789887 13:43991167-43991189 TGGTAAACATGTATTTGTGGAGG - Intergenic
1108997958 13:56759309-56759331 TGGTAGGGATACATCTGTGGAGG - Intergenic
1114419751 14:22571475-22571497 AGGTGTGCATGGATTTCTGGGGG + Intronic
1115251637 14:31354966-31354988 TGGTATGCATACTATGGTGGTGG - Intronic
1120593888 14:86410086-86410108 AGGTATGCATATATGTGTGTAGG - Intergenic
1126024391 15:44432106-44432128 TGGTGGGGATAGAATTGTGGTGG + Intronic
1133742580 16:8662578-8662600 TGGGATGCATGGACTGGTGGTGG + Intergenic
1139753542 16:69124231-69124253 TGTGATGCATAGATTCATGGGGG + Intronic
1140436916 16:74954676-74954698 TGGTATGAACATATGTGTGGAGG - Intronic
1145400695 17:22529963-22529985 TGGAAGGCCTAGAATTGTGGGGG - Intergenic
1147138702 17:38449641-38449663 TGGGATGCACGGATCTGTGGTGG + Intronic
1155571925 18:27203998-27204020 TGGTATGCCTAGAATTCAGGGGG - Intergenic
1156865413 18:41883893-41883915 TGGAGAGCAGAGATTTGTGGAGG + Intergenic
1158929533 18:62309789-62309811 TTGCATGAATAGATTTCTGGAGG + Intergenic
1159935127 18:74359793-74359815 TGTTATGAATAGACTTGGGGTGG + Intergenic
1160379790 18:78445123-78445145 TGTTATGCATAATTTTGTAGGGG - Intergenic
1167359290 19:49021349-49021371 TGGTCTGTACAGATTGGTGGAGG + Intergenic
925713062 2:6760285-6760307 TGGTATGCACACATGTGTGACGG + Intergenic
925733345 2:6938697-6938719 AGGGATGCAGAGATTTTTGGAGG - Intronic
926383361 2:12313180-12313202 TTGTTTGCTTAGATTTGTGGTGG - Intergenic
928746806 2:34425386-34425408 TGGCATAAATTGATTTGTGGGGG - Intergenic
929278189 2:40048297-40048319 TGGTATACATGTATTTGTGTCGG - Intergenic
929840784 2:45460575-45460597 TGTTCTGCATTGGTTTGTGGTGG + Intronic
931937400 2:67214335-67214357 TGGTGTGCATATATGTGTTGGGG - Intergenic
931937526 2:67215031-67215053 TGGTATGCATGTGTGTGTGGAGG - Intergenic
933479817 2:82841464-82841486 TAGAATAAATAGATTTGTGGAGG + Intergenic
934062992 2:88313424-88313446 TGGGAAGCATAGCTTTGTGGTGG + Intergenic
937275142 2:120679347-120679369 TGGTATGCACACATTTTTGGTGG - Intergenic
938774633 2:134530623-134530645 TGGTTTGGGTAGATTTGTTGAGG - Intronic
939679848 2:145116947-145116969 AAGTATGCATAGATTTGGAGGGG - Intergenic
940287306 2:152045081-152045103 TGCTAGGCATAGTTATGTGGTGG - Intronic
940806490 2:158193269-158193291 TTTTATGCATAGAATTGGGGCGG - Intronic
945692599 2:213057791-213057813 TGGTGTGCATAGATTAGAGTTGG - Intronic
945796435 2:214370196-214370218 TAATATGGAGAGATTTGTGGTGG - Intronic
1170534341 20:17325086-17325108 TGTTGTGCATGCATTTGTGGGGG - Intronic
1170786813 20:19474299-19474321 TGGTATCCAGAGAATGGTGGAGG + Intronic
1177350607 21:19935980-19936002 TGGAGAGAATAGATTTGTGGAGG - Intergenic
1179305283 21:40148619-40148641 TGGTAAGCATTGATTGGTGGTGG - Intronic
1182190464 22:28455124-28455146 TGGTATGAATATTGTTGTGGGGG - Intronic
950820772 3:15756086-15756108 TGGTATGCATAGATTTGTGGGGG - Intronic
951671743 3:25190953-25190975 TGGTTTGCATGGATCTGTGTTGG + Intronic
952423094 3:33148786-33148808 TGGGAGGCATGGATCTGTGGTGG + Intergenic
954858131 3:53664231-53664253 TGGAATGCTTAGTTTTGTTGGGG + Intronic
954893406 3:53953955-53953977 TGCTATGAAAAGGTTTGTGGGGG + Intergenic
956605675 3:71070779-71070801 TGGTATGCAGGGATTTGTACAGG - Intronic
958818411 3:98944336-98944358 TGGAATGCAAATATATGTGGTGG + Intergenic
959266802 3:104151232-104151254 TGGTATGTTTAGATTTAAGGTGG + Intergenic
959395858 3:105837322-105837344 TCGAAAGCATAGATTTTTGGAGG + Intronic
961025484 3:123551886-123551908 TGATCTGTATAGATTTTTGGAGG - Intronic
961716038 3:128858126-128858148 TGGACTGCATAGATCTGTGAGGG + Intergenic
965944381 3:174222457-174222479 AAGTGTGCATTGATTTGTGGTGG - Intronic
966326613 3:178763078-178763100 AAGGATGTATAGATTTGTGGTGG + Intronic
971788095 4:31131008-31131030 TAGGATGCATACATTTTTGGAGG + Intronic
972065707 4:34940617-34940639 TTGAAAGCATTGATTTGTGGTGG + Intergenic
972717860 4:41666068-41666090 TGCTTTGCATAAATTTGTGGGGG + Intronic
973532902 4:51850932-51850954 TGGGGTGCTTAGAGTTGTGGGGG + Intronic
974810414 4:66938656-66938678 TGGTATTTATAGATTTATGGTGG - Intergenic
977648118 4:99437711-99437733 TGGTGTGCACAGAATTGAGGGGG + Intergenic
977876456 4:102155851-102155873 TGGTATGTATAGTTCTGTAGAGG - Intergenic
980863737 4:138529760-138529782 TGGCATGCATGGGTGTGTGGTGG - Intergenic
980922473 4:139100843-139100865 TGGTGAGCATAGATTGCTGGGGG + Intronic
981179376 4:141721156-141721178 TGGGAACCATAGATTTGTGCAGG + Intronic
981581645 4:146254876-146254898 TGGTTAGCATAGATTTTTGCAGG + Intronic
983789207 4:171774474-171774496 TGGGAAGCATAGATCTGTGTAGG - Intergenic
984118103 4:175707327-175707349 TAGTATGTTTTGATTTGTGGAGG + Intronic
990754421 5:59052554-59052576 TGGAAAGCAAAGAGTTGTGGAGG + Intronic
991651011 5:68853469-68853491 AGATATACATAGATTTGTGATGG + Intergenic
993774950 5:91981997-91982019 TGGAGGTCATAGATTTGTGGTGG - Intergenic
996117218 5:119632463-119632485 TGATATGTGTAGATTTGTGTGGG - Intronic
1000921791 5:167146588-167146610 TGGTAAGTATAGATTTGAGTTGG - Intergenic
1003804325 6:9709167-9709189 TTGTATTCATAGATTTTTAGTGG - Intronic
1004213902 6:13683157-13683179 TAGTATGGATAGTTTTTTGGAGG - Intronic
1004527362 6:16421786-16421808 TGATATGCATACATGTGTGCAGG + Intronic
1004766649 6:18736163-18736185 TGGTCTGTATAGGTTTCTGGAGG - Intergenic
1004922426 6:20388455-20388477 TGGAATGCATGGCTTGGTGGAGG - Intergenic
1006972812 6:38064234-38064256 TGGCTTGAATTGATTTGTGGTGG - Intronic
1008200259 6:48578696-48578718 TGGAATGCATATATATGTGGAGG + Intergenic
1009296956 6:61963124-61963146 TGCTTTGCATATATTTGTGATGG - Intronic
1009781996 6:68283653-68283675 GAGTTTGCATAGATTTTTGGTGG - Intergenic
1010134854 6:72539393-72539415 AGGAATGCATACATTTTTGGTGG - Intergenic
1011858631 6:91726841-91726863 AGGTAGGCCTAGAATTGTGGGGG - Intergenic
1014805207 6:125821484-125821506 TGGGTTGCATAGATTTCTGTGGG + Intronic
1015329178 6:131956976-131956998 TAGTTTTCATTGATTTGTGGAGG + Intergenic
1021280709 7:18714447-18714469 GGGAATGAATAGAATTGTGGAGG - Intronic
1022263792 7:28733387-28733409 TGGTGTGCAGAGATGAGTGGAGG - Intronic
1022553819 7:31271319-31271341 TGTTCTGCAGTGATTTGTGGTGG + Intergenic
1025080416 7:55977029-55977051 TGGTATTCTGAGGTTTGTGGGGG + Intronic
1029943371 7:104504862-104504884 TGTTCTTCATAGACTTGTGGTGG + Intronic
1031437499 7:121751193-121751215 GGGTATGCATATATCTGTGTTGG + Intergenic
1032974080 7:137201543-137201565 ATATATGCATAGATTTGTAGGGG - Intergenic
1035694133 8:1581853-1581875 TGGTGTGTATATATGTGTGGGGG - Intronic
1044221845 8:89678610-89678632 TGATATGCAGAGCTGTGTGGAGG + Intergenic
1045124905 8:99078824-99078846 TGGTATGCATAGGTGAGTGCTGG + Intronic
1046220873 8:111212462-111212484 AGGTATGCAGAAATTTGTTGTGG - Intergenic
1046614978 8:116466337-116466359 GGCTTTGCAAAGATTTGTGGAGG + Intergenic
1047104238 8:121715890-121715912 TGGACTGCATAGCTTTGTTGTGG - Intergenic
1047612916 8:126538680-126538702 TTGTATGCCTGGATTTGTGCTGG - Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1052838759 9:33272885-33272907 ATGTATGCAAACATTTGTGGAGG - Intronic
1057269794 9:93644428-93644450 TGGTGTGCAAAGAATTCTGGCGG + Intronic
1057824844 9:98364466-98364488 GGGTATGCCTAGATTCATGGAGG - Intronic
1058664118 9:107294118-107294140 TGGTAAGTTTAGCTTTGTGGCGG + Intronic
1059034346 9:110737803-110737825 TGCTCTGCATATGTTTGTGGAGG + Intronic
1203343692 Un_KI270442v1:16455-16477 TGGAATGCAGAGAATTGTAGTGG + Intergenic
1185500836 X:596132-596154 AGGTGGACATAGATTTGTGGGGG - Intergenic
1185842361 X:3403714-3403736 TGGAATGCATGGTTTAGTGGAGG - Intergenic
1194079735 X:89445110-89445132 TGGTTTGCATTGATTTATGAAGG - Intergenic
1195224198 X:102775611-102775633 TAGTATGAATAGTTTTTTGGTGG + Intergenic
1195438662 X:104875624-104875646 AGGAATGCATATATCTGTGGGGG - Intronic
1197144919 X:123160729-123160751 TGGTTTCCAGAGATTGGTGGGGG - Intergenic
1199161189 X:144614105-144614127 TGGTAAGCAGAGTTTTCTGGAGG + Intergenic
1200432353 Y:3100399-3100421 TGGTTTGCATTGATTTATGAAGG - Intergenic
1201261805 Y:12165776-12165798 TGGACTGCATACATTAGTGGGGG + Intergenic
1201743098 Y:17344254-17344276 TGAGATGAATAGATGTGTGGAGG + Intergenic