ID: 950824645

View in Genome Browser
Species Human (GRCh38)
Location 3:15805000-15805022
Sequence CTACGTAAGTACATGTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950824645 Original CRISPR CTACGTAAGTACATGTGTGT TGG (reversed) Intronic
900978214 1:6030824-6030846 ATGTGTAAGTATATGTGTGTAGG + Intronic
905027768 1:34862942-34862964 CCATGGAAGCACATGTGTGTTGG - Intergenic
907516544 1:54996717-54996739 TTAAGTAAGGACATGTGTGTAGG - Intergenic
912470082 1:109900856-109900878 CTAGGCAGGTACAGGTGTGTAGG + Intergenic
917833639 1:178921492-178921514 CTACTAAAGAACATGTGTGTGGG + Intronic
922556739 1:226538349-226538371 CTACAGAAGTACATATGTATTGG + Intergenic
922795916 1:228339724-228339746 TTACATATGTACATGTATGTGGG - Intronic
923724332 1:236493480-236493502 GTACATATGTACATGTGTATGGG + Intergenic
923724334 1:236493504-236493526 GTACATATGTACATGTGTATGGG + Intergenic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1074928264 10:118095800-118095822 GTACGTAAGAACTTGTGTGGTGG - Intergenic
1076132545 10:128023578-128023600 TTACGTAGGTACATATGTATAGG + Intronic
1077425102 11:2472193-2472215 CTATGTGTGCACATGTGTGTAGG + Intronic
1079363837 11:19792179-19792201 GGACCTAAGTATATGTGTGTTGG - Intronic
1087317460 11:96619893-96619915 CTACATTAGTATATGTCTGTAGG - Intergenic
1088298343 11:108326772-108326794 CTAAGCAGGTACATGTCTGTGGG - Intronic
1091947973 12:4565923-4565945 CTATGAAAGTACATGTGGGATGG - Intronic
1092193512 12:6535876-6535898 ACAGGTAAGTGCATGTGTGTGGG - Intronic
1092440885 12:8501796-8501818 AAAAGTAAGTACATGTGTTTTGG - Intergenic
1092878650 12:12870692-12870714 CTACGTAAGTCCATGGTTATGGG + Intergenic
1096047321 12:48574136-48574158 CTTGGTAATTACATGTGTATCGG - Intergenic
1096227821 12:49877826-49877848 CTATGTGCGTATATGTGTGTAGG + Intronic
1099042890 12:77677747-77677769 CTACATAAATAAATGTGTTTTGG + Intergenic
1099810374 12:87574135-87574157 ATATTTAAGTACATGTGTTTAGG - Intergenic
1100174217 12:92011101-92011123 CTAAGAAACTACATGTGTGAAGG - Intronic
1104607017 12:130197487-130197509 CTATGTATGTATGTGTGTGTGGG + Intergenic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1106969471 13:35120914-35120936 CTAGGTATGTAGATGTGTGATGG + Intronic
1109514994 13:63432252-63432274 CTACATAAACATATGTGTGTGGG + Intergenic
1112672736 13:101659797-101659819 ATATGTAAGTATATGTGTGTAGG + Intronic
1113643434 13:111974941-111974963 GCACATATGTACATGTGTGTGGG + Intergenic
1117417232 14:55508265-55508287 CTAAGAATGTACATGTGTGCCGG - Intergenic
1119272572 14:73321811-73321833 CTATGTATGTATATATGTGTAGG + Intronic
1120200298 14:81531705-81531727 CTACGTAACTCCAGGTGTGATGG - Intronic
1126939267 15:53748375-53748397 CTACATAAGTATATTTGTTTTGG + Intronic
1127604517 15:60573005-60573027 CTGAGTAAGTACATGAGTGTGGG + Intronic
1131651781 15:94407756-94407778 GTGCACAAGTACATGTGTGTTGG - Intronic
1133422270 16:5656165-5656187 CTTCTTAGGTGCATGTGTGTAGG + Intergenic
1139160329 16:64498353-64498375 TTACTGAAGGACATGTGTGTGGG + Intergenic
1140164373 16:72534175-72534197 CTATGTAAGTACAAATGAGTTGG - Intergenic
1140784011 16:78322814-78322836 CTACGTAAGAAAATGAGTATGGG + Intronic
1141928899 16:87187511-87187533 GTATGTGTGTACATGTGTGTGGG + Intronic
1142321322 16:89384833-89384855 GTGTGTAAGAACATGTGTGTGGG + Intronic
1145751814 17:27360803-27360825 TTCCCTAAGTACGTGTGTGTGGG + Intergenic
1146913313 17:36661853-36661875 CTACGCACGCACATGTGTGTGGG - Intergenic
1149244312 17:54687307-54687329 GTACACAAGCACATGTGTGTTGG + Intergenic
1159477178 18:68936878-68936900 TTACGTATGTATATGTGTGTTGG - Intronic
1161692141 19:5742236-5742258 GTACGTATGTGAATGTGTGTGGG + Intronic
1166771678 19:45287274-45287296 CTAAGTCAGTATATGTGCGTTGG + Intronic
1167282796 19:48580231-48580253 CCACGTAAGAACTTGTGTGCAGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930930587 2:56876904-56876926 CTAGGTAATTACATGTGGTTTGG - Intergenic
933320495 2:80770395-80770417 CTATGTATGTGCGTGTGTGTGGG - Intergenic
933916733 2:87002243-87002265 CTACATATATACATGAGTGTTGG + Intronic
934006261 2:87767671-87767693 CTACATATATACATGAGTGTTGG - Intronic
935769911 2:106408561-106408583 CTACATATATACATGAGTGTTGG - Intronic
935910183 2:107887362-107887384 CTACATATATACATGAGTGTTGG + Intronic
935968301 2:108504208-108504230 CTACATATATACATGAGTGTTGG + Intronic
936131974 2:109852503-109852525 CTACATACATACATGAGTGTTGG + Intronic
936212723 2:110518982-110519004 CTACATACATACATGAGTGTTGG - Intronic
936421863 2:112373562-112373584 CTACATATATACATGAGTGTTGG - Intronic
938546375 2:132336583-132336605 CTACTTTAATCCATGTGTGTTGG - Intergenic
941564507 2:167089606-167089628 TTACTTAAGTAAATGTGTGTGGG + Intronic
948679684 2:239625440-239625462 CTAAGTGTGTCCATGTGTGTTGG - Intergenic
1179191441 21:39125671-39125693 GTGTGTGAGTACATGTGTGTTGG - Intergenic
1181488165 22:23244689-23244711 CTCAGTAAGTACATTTGTCTGGG + Intronic
1181490475 22:23258125-23258147 ATACACACGTACATGTGTGTGGG - Intronic
949918710 3:8985115-8985137 ATACGTATGTACGTGTCTGTAGG - Exonic
950824645 3:15805000-15805022 CTACGTAAGTACATGTGTGTTGG - Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
956801331 3:72762072-72762094 GTATGTATGTACATGTTTGTGGG - Intronic
957795530 3:85000819-85000841 CTATGTATGTACATTTGTATAGG + Intronic
963287163 3:143444499-143444521 GTAGGTATGTACGTGTGTGTTGG - Intronic
966078026 3:175962948-175962970 CAAGGTGAGTACATCTGTGTGGG + Intergenic
970958567 4:21845065-21845087 ATAAGTAAGTATATGTGGGTAGG - Intronic
975123303 4:70753429-70753451 CTACTTATATACATGTATGTTGG + Intronic
978299586 4:107251800-107251822 CTATGAAAATATATGTGTGTGGG + Intronic
979882576 4:125980256-125980278 CTACGCATGTGCATGTGTGTGGG + Intergenic
981655729 4:147110643-147110665 CTACTCAACTTCATGTGTGTGGG + Intergenic
982878911 4:160686050-160686072 CTACCTATGTGCATGTGTGCTGG - Intergenic
984175143 4:176408193-176408215 CCAAGTAAGAACATGTGAGTTGG - Intergenic
984178164 4:176446006-176446028 ATACGTAAGTAGAAATGTGTAGG - Intergenic
985833784 5:2256074-2256096 CTCTGTATGTGCATGTGTGTGGG + Intergenic
986789350 5:11144811-11144833 CTAAGGAAATAGATGTGTGTAGG + Intronic
994438220 5:99764911-99764933 CAAGGTAAGAAAATGTGTGTGGG - Intergenic
996127871 5:119747332-119747354 TTACATAAGTATATGTTTGTTGG + Intergenic
1002076948 5:176713936-176713958 AGACGTAAGCAAATGTGTGTGGG - Intergenic
1008178316 6:48295330-48295352 CTACCTATATACATGTGTTTTGG + Intergenic
1013987216 6:116209365-116209387 CTACAGAAGTAAGTGTGTGTGGG - Intronic
1014448892 6:121560432-121560454 CTACGGAACTGCATGTGTTTTGG + Intergenic
1014499480 6:122167487-122167509 CTATGTGTGTATATGTGTGTTGG + Intergenic
1021485896 7:21168232-21168254 CTACGTGTGCACGTGTGTGTGGG + Intergenic
1024051359 7:45625619-45625641 ACACGTGTGTACATGTGTGTAGG + Intronic
1030422772 7:109329400-109329422 CTAGGTGAGTTCATGTGTCTAGG + Intergenic
1034526872 7:151670173-151670195 ATATGTGAGTGCATGTGTGTGGG - Intronic
1035704259 8:1663073-1663095 GTGCGTTTGTACATGTGTGTGGG + Intronic
1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG + Intronic
1044796642 8:95907307-95907329 ATATGTATGTATATGTGTGTAGG - Intergenic
1046739020 8:117809171-117809193 GTATGTATGTGCATGTGTGTAGG + Intronic
1047676228 8:127206147-127206169 TTATGTATGTATATGTGTGTGGG + Intergenic
1048674254 8:136759601-136759623 CTGAGTGAGTATATGTGTGTGGG + Intergenic
1049205392 8:141361231-141361253 CCAAGGAAGTACCTGTGTGTGGG - Intronic
1049523352 8:143106649-143106671 TTACATAGGTACATGTGTGCCGG - Intergenic
1049523382 8:143106847-143106869 TTACATAGGTACATGTGTGCCGG - Intergenic
1055195951 9:73594053-73594075 CTACATACATATATGTGTGTGGG + Intergenic
1059387038 9:113972703-113972725 CTATGTAAGTAATAGTGTGTTGG - Intronic
1060746355 9:126135737-126135759 CTACTTTAGTCCATGTGTATGGG + Intergenic
1060754801 9:126204742-126204764 CTATGTATGTATCTGTGTGTGGG + Intergenic
1186996751 X:15131753-15131775 CTATTTAAGTACAAGTGTGTTGG + Intergenic
1187789757 X:22937441-22937463 TTACGTCAGAAAATGTGTGTTGG + Intergenic
1189363846 X:40372856-40372878 GTACGTGTGTACATTTGTGTAGG + Intergenic
1198922272 X:141743133-141743155 CTACTTAAGTATATTTTTGTGGG - Intergenic