ID: 950828681 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:15852945-15852967 |
| Sequence | TCTTCTATGTGTATGCTGAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 160 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 147} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 950828681_950828685 | 18 | Left | 950828681 | 3:15852945-15852967 | CCAATCAGCATACACATAGAAGA | 0: 1 1: 0 2: 0 3: 12 4: 147 |
||
| Right | 950828685 | 3:15852986-15853008 | TAAATCAGTATCGCTTAAGGAGG | 0: 1 1: 0 2: 0 3: 13 4: 117 |
||||
| 950828681_950828687 | 22 | Left | 950828681 | 3:15852945-15852967 | CCAATCAGCATACACATAGAAGA | 0: 1 1: 0 2: 0 3: 12 4: 147 |
||
| Right | 950828687 | 3:15852990-15853012 | TCAGTATCGCTTAAGGAGGGTGG | 0: 1 1: 0 2: 0 3: 1 4: 53 |
||||
| 950828681_950828684 | 15 | Left | 950828681 | 3:15852945-15852967 | CCAATCAGCATACACATAGAAGA | 0: 1 1: 0 2: 0 3: 12 4: 147 |
||
| Right | 950828684 | 3:15852983-15853005 | TTTTAAATCAGTATCGCTTAAGG | 0: 1 1: 0 2: 1 3: 15 4: 153 |
||||
| 950828681_950828686 | 19 | Left | 950828681 | 3:15852945-15852967 | CCAATCAGCATACACATAGAAGA | 0: 1 1: 0 2: 0 3: 12 4: 147 |
||
| Right | 950828686 | 3:15852987-15853009 | AAATCAGTATCGCTTAAGGAGGG | 0: 1 1: 0 2: 0 3: 9 4: 96 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 950828681 | Original CRISPR | TCTTCTATGTGTATGCTGAT TGG (reversed) | Intronic | ||