ID: 950828681

View in Genome Browser
Species Human (GRCh38)
Location 3:15852945-15852967
Sequence TCTTCTATGTGTATGCTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950828681_950828685 18 Left 950828681 3:15852945-15852967 CCAATCAGCATACACATAGAAGA 0: 1
1: 0
2: 0
3: 12
4: 147
Right 950828685 3:15852986-15853008 TAAATCAGTATCGCTTAAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 117
950828681_950828687 22 Left 950828681 3:15852945-15852967 CCAATCAGCATACACATAGAAGA 0: 1
1: 0
2: 0
3: 12
4: 147
Right 950828687 3:15852990-15853012 TCAGTATCGCTTAAGGAGGGTGG 0: 1
1: 0
2: 0
3: 1
4: 53
950828681_950828684 15 Left 950828681 3:15852945-15852967 CCAATCAGCATACACATAGAAGA 0: 1
1: 0
2: 0
3: 12
4: 147
Right 950828684 3:15852983-15853005 TTTTAAATCAGTATCGCTTAAGG 0: 1
1: 0
2: 1
3: 15
4: 153
950828681_950828686 19 Left 950828681 3:15852945-15852967 CCAATCAGCATACACATAGAAGA 0: 1
1: 0
2: 0
3: 12
4: 147
Right 950828686 3:15852987-15853009 AAATCAGTATCGCTTAAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950828681 Original CRISPR TCTTCTATGTGTATGCTGAT TGG (reversed) Intronic