ID: 950828683

View in Genome Browser
Species Human (GRCh38)
Location 3:15852970-15852992
Sequence TGATTTAAAAAAAAGTTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 971
Summary {0: 1, 1: 0, 2: 9, 3: 89, 4: 872}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950828683_950828689 30 Left 950828683 3:15852970-15852992 CCTGGTAACTTTTTTTTAAATCA 0: 1
1: 0
2: 9
3: 89
4: 872
Right 950828689 3:15853023-15853045 TAATAGCATAACTAAGAATTGGG 0: 1
1: 0
2: 2
3: 23
4: 234
950828683_950828684 -10 Left 950828683 3:15852970-15852992 CCTGGTAACTTTTTTTTAAATCA 0: 1
1: 0
2: 9
3: 89
4: 872
Right 950828684 3:15852983-15853005 TTTTAAATCAGTATCGCTTAAGG 0: 1
1: 0
2: 1
3: 15
4: 153
950828683_950828688 29 Left 950828683 3:15852970-15852992 CCTGGTAACTTTTTTTTAAATCA 0: 1
1: 0
2: 9
3: 89
4: 872
Right 950828688 3:15853022-15853044 TTAATAGCATAACTAAGAATTGG 0: 1
1: 0
2: 0
3: 15
4: 240
950828683_950828685 -7 Left 950828683 3:15852970-15852992 CCTGGTAACTTTTTTTTAAATCA 0: 1
1: 0
2: 9
3: 89
4: 872
Right 950828685 3:15852986-15853008 TAAATCAGTATCGCTTAAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 117
950828683_950828687 -3 Left 950828683 3:15852970-15852992 CCTGGTAACTTTTTTTTAAATCA 0: 1
1: 0
2: 9
3: 89
4: 872
Right 950828687 3:15852990-15853012 TCAGTATCGCTTAAGGAGGGTGG 0: 1
1: 0
2: 0
3: 1
4: 53
950828683_950828686 -6 Left 950828683 3:15852970-15852992 CCTGGTAACTTTTTTTTAAATCA 0: 1
1: 0
2: 9
3: 89
4: 872
Right 950828686 3:15852987-15853009 AAATCAGTATCGCTTAAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950828683 Original CRISPR TGATTTAAAAAAAAGTTACC AGG (reversed) Intronic