ID: 950828685

View in Genome Browser
Species Human (GRCh38)
Location 3:15852986-15853008
Sequence TAAATCAGTATCGCTTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950828681_950828685 18 Left 950828681 3:15852945-15852967 CCAATCAGCATACACATAGAAGA 0: 1
1: 0
2: 0
3: 12
4: 147
Right 950828685 3:15852986-15853008 TAAATCAGTATCGCTTAAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 117
950828683_950828685 -7 Left 950828683 3:15852970-15852992 CCTGGTAACTTTTTTTTAAATCA 0: 1
1: 0
2: 9
3: 89
4: 872
Right 950828685 3:15852986-15853008 TAAATCAGTATCGCTTAAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950828685 Original CRISPR TAAATCAGTATCGCTTAAGG AGG Intronic