ID: 950828685

View in Genome Browser
Species Human (GRCh38)
Location 3:15852986-15853008
Sequence TAAATCAGTATCGCTTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950828681_950828685 18 Left 950828681 3:15852945-15852967 CCAATCAGCATACACATAGAAGA 0: 1
1: 0
2: 0
3: 12
4: 147
Right 950828685 3:15852986-15853008 TAAATCAGTATCGCTTAAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 117
950828683_950828685 -7 Left 950828683 3:15852970-15852992 CCTGGTAACTTTTTTTTAAATCA 0: 1
1: 0
2: 9
3: 89
4: 872
Right 950828685 3:15852986-15853008 TAAATCAGTATCGCTTAAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950828685 Original CRISPR TAAATCAGTATCGCTTAAGG AGG Intronic
908903659 1:68984062-68984084 TAAATCAGGATTGCTAAAGGTGG + Intergenic
911445079 1:97982473-97982495 TAAATCAGAATCTCTGTAGGTGG - Intergenic
912646058 1:111393157-111393179 TAAATCAATATTGCTTAGTGTGG - Intergenic
913371470 1:118104352-118104374 TAAATGAGTTTTACTTAAGGTGG + Intronic
917047828 1:170882706-170882728 TCTATCAGTATTGCTCAAGGTGG + Intergenic
917540936 1:175913813-175913835 TTAATCAGAATCTCATAAGGGGG + Intergenic
920756212 1:208736418-208736440 TAAATCAGAATCCCTAAAGGTGG - Intergenic
921975034 1:221192836-221192858 TAAATCAGAATCTCTCAGGGTGG - Intergenic
922013423 1:221616728-221616750 AAAAGCAGTATAGCTTAAGCAGG + Intergenic
924481302 1:244437172-244437194 TAAATCAGTATCTTTCAAGTTGG + Intronic
1064704002 10:18051469-18051491 TAACTCATTATCGCTTCAAGTGG - Intergenic
1065945753 10:30604419-30604441 TAAATCAGTCTCCCTGAAGATGG - Intergenic
1067011782 10:42720940-42720962 GAGATCAGTATTGCTTAAGATGG - Intergenic
1067311806 10:45120916-45120938 AAGATCAGTATTGCTTAAGATGG + Intergenic
1068310936 10:55274201-55274223 TCAATCAGTATTGCTGAGGGAGG - Intronic
1077649327 11:3955711-3955733 TAAATCAGTATCTCTCTGGGTGG - Intronic
1087173378 11:95073825-95073847 TAAATCAGTATCTCTGGAAGTGG + Intergenic
1087285719 11:96263156-96263178 TAAATCAGAATTGATTAAAGAGG - Intronic
1087985213 11:104670279-104670301 TAAATCAGTATCTCTTATTAAGG + Intergenic
1091083017 11:132690325-132690347 TGAATCAGTATAGCTGAAGTGGG + Intronic
1093063276 12:14629795-14629817 TAAATCAGAATGACTTAGGGTGG - Intronic
1095583446 12:43825760-43825782 TAAACCAGAATCTCTTGAGGTGG - Intergenic
1097395768 12:59072860-59072882 TAGATCAGTGTTGCTTAAAGTGG + Intergenic
1097739012 12:63216652-63216674 TAAATTAGTTTTGCTTAAGAAGG - Intergenic
1099228355 12:79995005-79995027 TAATTCAGTATAGCGTGAGGTGG - Intergenic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1100333761 12:93610380-93610402 TGAATCAGAATCTCTAAAGGTGG - Intergenic
1110253340 13:73405090-73405112 TAAATCAGTATTTCTTACTGGGG - Intergenic
1113417243 13:110137986-110138008 AAAATGAATATCCCTTAAGGCGG + Intergenic
1117025144 14:51611447-51611469 TAAATCAGAATCTCTAGAGGTGG - Intronic
1120838995 14:89066464-89066486 TAAATCAGAATCCCTGAGGGCGG - Intergenic
1125377280 15:39043506-39043528 TAACTCAGAATCTCTGAAGGTGG - Intergenic
1126847082 15:52770259-52770281 TAAATCAGTATCTCTGGAGATGG - Intronic
1127158986 15:56160555-56160577 TGAATCAGTGTCGCTTGAGGGGG - Intronic
1132479939 16:162367-162389 TAAATCAGTAGAGCTGGAGGAGG + Intronic
1132486231 16:192965-192987 GAAATCAGGATCGCTTGAGGAGG - Exonic
1133159484 16:3900937-3900959 TAGATCAGTGTTGCTTAGGGTGG + Intergenic
1134801963 16:17092666-17092688 TAAATCAGAATCTCTGGAGGTGG - Intergenic
1138062448 16:53906203-53906225 TAAATCTGTATCTCTGGAGGTGG - Intronic
1141102576 16:81208897-81208919 TGAATCAGAATCGCTGAGGGTGG - Intergenic
1146940559 17:36841448-36841470 AAAATCAGTATCTCCTCAGGAGG - Intergenic
1149897752 17:60442528-60442550 AAATTCAGTATCACTGAAGGTGG + Intergenic
1153909947 18:9697912-9697934 TAAACCAGTATCACATAAGAAGG + Intergenic
1155508881 18:26557548-26557570 TAAATCAGAATCTCTGAAGTTGG - Intronic
1157050227 18:44155137-44155159 TAAGTCAGAATCTCTTGAGGTGG + Intergenic
1157681364 18:49609819-49609841 TGCATCAGTATCACTGAAGGTGG - Intergenic
1158520204 18:58165978-58166000 TAAATCAGAATCCCTGCAGGTGG - Intronic
1158915738 18:62127006-62127028 TAAAGCAGTATTTCTCAAGGAGG + Intronic
1162882887 19:13673326-13673348 TAAATCAAAATCTCTGAAGGTGG + Intergenic
1165580434 19:36858120-36858142 TAAATCAGAATTGCTGAGGGTGG - Intronic
1167704109 19:51068338-51068360 TAAATAAGTAAAGCTTAAGATGG + Intergenic
927448336 2:23185340-23185362 TAAATCAGTATTACCTAGGGAGG + Intergenic
928868808 2:35950413-35950435 TAAATCAGAATCTCTGAGGGTGG + Intergenic
929317498 2:40497493-40497515 TAAATCAGTATTGGGTAAGGGGG + Intronic
931123021 2:59241643-59241665 TAAATCAGAATCTCTGAGGGTGG - Intergenic
932509493 2:72271371-72271393 TTAAGCAGTATCTCTTGAGGAGG + Intronic
934930650 2:98419916-98419938 TAAATCAGCATCTCTGAAGACGG - Intergenic
936955487 2:118018033-118018055 TAAATCAGGATTGCTAAGGGTGG - Intergenic
939193717 2:138946555-138946577 TAAATCAGAATAGCTGCAGGAGG - Intergenic
942197951 2:173541361-173541383 TAAATCAGAATCTCTGGAGGTGG + Intergenic
943485558 2:188474645-188474667 TAACTCAGTATCACTGAAAGAGG - Intronic
944391061 2:199220231-199220253 TATATCAGAATTTCTTAAGGTGG - Intergenic
1178098898 21:29244736-29244758 TAAATCAGTTTTGTTAAAGGTGG + Intronic
1179015197 21:37590022-37590044 TAAAACAGTATCGTCTAAGTTGG + Intergenic
950828685 3:15852986-15853008 TAAATCAGTATCGCTTAAGGAGG + Intronic
952139974 3:30467066-30467088 TAACTTACTATCGCTAAAGGAGG - Intergenic
955152924 3:56386515-56386537 TAAATCAGTATCTCTGCAGTTGG + Intronic
955904424 3:63791584-63791606 TAAATCAGAATCTCTTGGGGTGG - Intergenic
958962582 3:100523993-100524015 GAAATAAGGATCACTTAAGGAGG + Intronic
959844266 3:111014790-111014812 TGAATCAGAATCTCTGAAGGTGG + Intergenic
960586589 3:119325853-119325875 TAAATCAGAATCTCTGAAGGTGG + Intronic
960696339 3:120400356-120400378 TAAATCAGAATCTCTGAAGGTGG - Intronic
960713829 3:120556883-120556905 TAAATAAGTGTAGGTTAAGGGGG - Intergenic
963364910 3:144322901-144322923 TAATTCTGTATCTCTGAAGGAGG + Intergenic
966576003 3:181503322-181503344 TAAATCAGAATCTCTCGAGGTGG + Intergenic
973290621 4:48466694-48466716 TGAATCAGAATCTCTGAAGGAGG - Intergenic
975331526 4:73120215-73120237 TAAAGCTGTATCTCTTGAGGAGG + Exonic
976074789 4:81285262-81285284 TAAATCAGTAGTGCTGGAGGGGG - Intergenic
976803948 4:89024941-89024963 TAAATCAGTCGCTCTTAATGAGG - Intronic
977262783 4:94817993-94818015 TAAATCAGAAACTCTGAAGGTGG + Intronic
977941637 4:102865945-102865967 AAAAACACTATCGCATAAGGTGG + Intronic
979354964 4:119692149-119692171 TAAATCAGAATCTCTGGAGGTGG - Intergenic
981645505 4:146994266-146994288 TAAATCAGAATTTCTGAAGGTGG - Intergenic
983492984 4:168411288-168411310 TAACTCTGTATCACTGAAGGAGG + Intronic
984503017 4:180580203-180580225 TAAATCAGTAATTCTTAAGGTGG - Intergenic
988917150 5:35905878-35905900 TAAATCAGAATCTCTGAAGCAGG + Intronic
989432701 5:41374252-41374274 TAAATCAGAATCTCTGAAAGTGG + Intronic
990370313 5:55111304-55111326 TAAATCAGAATCTCTAGAGGTGG - Intergenic
990953095 5:61318007-61318029 TAAATCAGTCTCGAATAAAGGGG - Intergenic
994614693 5:102089617-102089639 TAACTCTGTATCACTTAAAGAGG - Intergenic
994931984 5:106201071-106201093 TAAATCAAAATCTCTTAAGGGGG + Intergenic
1000669220 5:164039851-164039873 TAAATCAGAATCCCTGGAGGTGG - Intergenic
1004024170 6:11803182-11803204 TAAATCAGAATCTCTTGGGGAGG - Intronic
1004526994 6:16418353-16418375 GAAAGAAGTATCGCTTAATGTGG - Intronic
1008376109 6:50794173-50794195 TGAATCAGTATTTCTGAAGGTGG + Intergenic
1015428266 6:133097852-133097874 TCAGTCAGTATCTCTGAAGGTGG - Intergenic
1017331645 6:153206138-153206160 AAATTCAGTATGGCTTAAGATGG - Intergenic
1023056375 7:36293455-36293477 TAAATCAGAATCTCTACAGGTGG + Intronic
1023425131 7:40028072-40028094 TAAATAAGTATGGATTAGGGAGG + Intronic
1030695712 7:112582729-112582751 TAAATCAGAATCTCTCAGGGTGG - Intergenic
1032694000 7:134317447-134317469 TAAATCAGAATCGCTGGGGGTGG - Intergenic
1036100943 8:5784206-5784228 TAAATGAATATAGCATAAGGTGG + Intergenic
1039723234 8:40187367-40187389 TAAATCAGAACCCCTGAAGGTGG - Intergenic
1041197636 8:55417040-55417062 TATATCAGTACCTCTGAAGGTGG + Intronic
1043340392 8:79230417-79230439 TAAGTCAGTATCACTAAAAGAGG - Intergenic
1043603918 8:81976192-81976214 TAAATCAGTATCAATTAATCAGG - Intergenic
1045206763 8:100050359-100050381 TAAATCAGAATCTCTGAAGGCGG + Intronic
1045231692 8:100312262-100312284 TAAATCAGAATCACTGAGGGTGG + Intronic
1045233054 8:100324394-100324416 TAAATCAGTAAATATTAAGGTGG - Intronic
1045270627 8:100658081-100658103 TAAATCAGGATCCCTGAAGGTGG - Intronic
1046010438 8:108539798-108539820 TAAATCTGTATTGTTTTAGGAGG + Intergenic
1047312624 8:123705365-123705387 TACATCAGAATCCCTTATGGTGG + Intronic
1053556492 9:39143320-39143342 TAAATCAGAATCGCTGGAGATGG - Intronic
1053820604 9:41963619-41963641 TAAATCAGAATCGCTGGAGATGG - Intronic
1054089469 9:60831747-60831769 TAAATCAGAATCGCTGGAGATGG - Intergenic
1054110880 9:61107305-61107327 TAAATCAGAATCGCTGGAGATGG - Intergenic
1054609977 9:67223820-67223842 TAAATCAGAATCGCTGGAGATGG + Intergenic
1055316632 9:75040465-75040487 TAAAACAGTATGGATTAAGGAGG + Intergenic
1056541745 9:87577439-87577461 TAAATCAGTATCTCTTGGGGGGG - Intronic
1056987557 9:91377623-91377645 TAAATCAGAATCCCTGAGGGTGG - Intergenic
1185964170 X:4581344-4581366 TAAGTGAGTATCCCTTGAGGGGG + Intergenic
1186533540 X:10323127-10323149 AAAATTAGTATGGCTTAAAGTGG - Intergenic
1186634207 X:11384738-11384760 TAAATCAGAATCTCTGGAGGTGG + Intronic
1187935330 X:24330430-24330452 TAAATCAGAATCTCTGGAGGTGG + Intergenic
1188272605 X:28159088-28159110 TAAATCAGTATATCTGGAGGTGG - Intergenic
1189264406 X:39702661-39702683 TAAATCAGAATCTCTGATGGTGG + Intergenic
1190874905 X:54452836-54452858 TAAATCAGAATCTCTGCAGGTGG + Intronic
1194758156 X:97762354-97762376 TACATCAGAATCTCTCAAGGTGG + Intergenic
1195591017 X:106627162-106627184 TAAATCAGAATCTCTGAGGGTGG - Intronic
1195770468 X:108345897-108345919 TAAATCAGACTCTCTGAAGGTGG + Intronic
1198619314 X:138488880-138488902 TGAATCAGAGTCTCTTAAGGTGG - Intergenic