ID: 950835227

View in Genome Browser
Species Human (GRCh38)
Location 3:15913130-15913152
Sequence GCCACCCCTTTGACTAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950835224_950835227 -1 Left 950835224 3:15913108-15913130 CCTGATTTTCCAGGTGCTGTCTG 0: 298
1: 1227
2: 1763
3: 1278
4: 894
Right 950835227 3:15913130-15913152 GCCACCCCTTTGACTAGGAAAGG No data
950835225_950835227 -10 Left 950835225 3:15913117-15913139 CCAGGTGCTGTCTGCCACCCCTT No data
Right 950835227 3:15913130-15913152 GCCACCCCTTTGACTAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950835227 Original CRISPR GCCACCCCTTTGACTAGGAA AGG Intergenic
No off target data available for this crispr