ID: 950838995

View in Genome Browser
Species Human (GRCh38)
Location 3:15948751-15948773
Sequence CTGGTTATGAAACATGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950838995_950838998 12 Left 950838995 3:15948751-15948773 CCAGACACATGTTTCATAACCAG No data
Right 950838998 3:15948786-15948808 CCCAGTTAAATAATAATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950838995 Original CRISPR CTGGTTATGAAACATGTGTC TGG (reversed) Intergenic
No off target data available for this crispr