ID: 950839527

View in Genome Browser
Species Human (GRCh38)
Location 3:15953794-15953816
Sequence GTACCCTGTTTTTCTGCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950839524_950839527 14 Left 950839524 3:15953757-15953779 CCTGGTCAATAGTCTAGCTGAAT No data
Right 950839527 3:15953794-15953816 GTACCCTGTTTTTCTGCAATAGG No data
950839522_950839527 24 Left 950839522 3:15953747-15953769 CCCAGTTGAACCTGGTCAATAGT No data
Right 950839527 3:15953794-15953816 GTACCCTGTTTTTCTGCAATAGG No data
950839523_950839527 23 Left 950839523 3:15953748-15953770 CCAGTTGAACCTGGTCAATAGTC No data
Right 950839527 3:15953794-15953816 GTACCCTGTTTTTCTGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950839527 Original CRISPR GTACCCTGTTTTTCTGCAAT AGG Intergenic
No off target data available for this crispr