ID: 950848419

View in Genome Browser
Species Human (GRCh38)
Location 3:16037906-16037928
Sequence GGTTTAAGGGGTACATGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950848415_950848419 -8 Left 950848415 3:16037891-16037913 CCAACTTTTGTTTTAGGTTTAAG No data
Right 950848419 3:16037906-16037928 GGTTTAAGGGGTACATGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950848419 Original CRISPR GGTTTAAGGGGTACATGTTC AGG Intergenic
No off target data available for this crispr