ID: 950850023

View in Genome Browser
Species Human (GRCh38)
Location 3:16053375-16053397
Sequence TGGTGGAAGACTTTGTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950850023_950850034 30 Left 950850023 3:16053375-16053397 CCTCATCACAAAGTCTTCCACCA No data
Right 950850034 3:16053428-16053450 TGAGACTCTTTCCATTTGTAAGG No data
950850023_950850028 5 Left 950850023 3:16053375-16053397 CCTCATCACAAAGTCTTCCACCA No data
Right 950850028 3:16053403-16053425 GTCTCTAGGACCCCCACCATAGG No data
950850023_950850025 -9 Left 950850023 3:16053375-16053397 CCTCATCACAAAGTCTTCCACCA No data
Right 950850025 3:16053389-16053411 CTTCCACCATGAAGGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950850023 Original CRISPR TGGTGGAAGACTTTGTGATG AGG (reversed) Intergenic
No off target data available for this crispr