ID: 950850380

View in Genome Browser
Species Human (GRCh38)
Location 3:16056723-16056745
Sequence CATGATGCAAAAATGTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950850380_950850391 17 Left 950850380 3:16056723-16056745 CCTACCTACATTTTTGCATCATG No data
Right 950850391 3:16056763-16056785 TATAGGGTAGCAGGGCTTTGAGG No data
950850380_950850387 1 Left 950850380 3:16056723-16056745 CCTACCTACATTTTTGCATCATG No data
Right 950850387 3:16056747-16056769 GAAGAAACCAGAGGGATATAGGG No data
950850380_950850389 8 Left 950850380 3:16056723-16056745 CCTACCTACATTTTTGCATCATG No data
Right 950850389 3:16056754-16056776 CCAGAGGGATATAGGGTAGCAGG No data
950850380_950850386 0 Left 950850380 3:16056723-16056745 CCTACCTACATTTTTGCATCATG No data
Right 950850386 3:16056746-16056768 GGAAGAAACCAGAGGGATATAGG No data
950850380_950850384 -8 Left 950850380 3:16056723-16056745 CCTACCTACATTTTTGCATCATG No data
Right 950850384 3:16056738-16056760 GCATCATGGGAAGAAACCAGAGG No data
950850380_950850390 9 Left 950850380 3:16056723-16056745 CCTACCTACATTTTTGCATCATG No data
Right 950850390 3:16056755-16056777 CAGAGGGATATAGGGTAGCAGGG No data
950850380_950850385 -7 Left 950850380 3:16056723-16056745 CCTACCTACATTTTTGCATCATG No data
Right 950850385 3:16056739-16056761 CATCATGGGAAGAAACCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950850380 Original CRISPR CATGATGCAAAAATGTAGGT AGG (reversed) Intergenic
No off target data available for this crispr