ID: 950859472

View in Genome Browser
Species Human (GRCh38)
Location 3:16135036-16135058
Sequence CCTCTCATGTTGCTGTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950859470_950859472 -9 Left 950859470 3:16135022-16135044 CCTTTCACTTGGGGCCTCTCATG No data
Right 950859472 3:16135036-16135058 CCTCTCATGTTGCTGTAGTCAGG No data
950859469_950859472 -2 Left 950859469 3:16135015-16135037 CCAGACACCTTTCACTTGGGGCC No data
Right 950859472 3:16135036-16135058 CCTCTCATGTTGCTGTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950859472 Original CRISPR CCTCTCATGTTGCTGTAGTC AGG Intergenic
No off target data available for this crispr