ID: 950862887

View in Genome Browser
Species Human (GRCh38)
Location 3:16165786-16165808
Sequence CGGGGTCTGTGATCCATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950862887_950862895 19 Left 950862887 3:16165786-16165808 CCTTCCATGGATCACAGACCCCG No data
Right 950862895 3:16165828-16165850 AAGTCTTAATCAACCATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950862887 Original CRISPR CGGGGTCTGTGATCCATGGA AGG (reversed) Intergenic
No off target data available for this crispr