ID: 950865763

View in Genome Browser
Species Human (GRCh38)
Location 3:16187978-16188000
Sequence CAGTGTCAGATGTGGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950865763 Original CRISPR CAGTGTCAGATGTGGGAACA AGG Intronic
900842246 1:5062202-5062224 GATTGTCTGATGTGGGTACAGGG + Intergenic
901854015 1:12032454-12032476 CAGGGACAGATGAGGAAACAGGG + Intergenic
903216579 1:21846633-21846655 CGTTGTCAGATTTGGGAACAGGG + Intronic
903869273 1:26420809-26420831 CAGTGTCAAATATGTCAACAAGG - Intronic
905215591 1:36405168-36405190 CAGTGTAAGACATGGGAAAATGG - Intergenic
905562931 1:38941663-38941685 CAGGGTAAGATGTGGGAGCTGGG - Intronic
905874885 1:41426375-41426397 AAGTGTCTGCTGTGGGAACCCGG + Intergenic
906957255 1:50384938-50384960 CACTGTCAATTGTGAGAACATGG - Intergenic
909026407 1:70487018-70487040 CAGGGTCTGCTGTGGGATCAAGG - Intergenic
911314314 1:96337797-96337819 CAATGTCTTTTGTGGGAACATGG + Intergenic
911381456 1:97120187-97120209 TGGTGTCAAATGTGAGAACAAGG - Intronic
911666888 1:100563539-100563561 CAGTGTCAGGAGTTGGCACAAGG - Intergenic
912628200 1:111223496-111223518 CTATGGCAGACGTGGGAACAAGG - Intronic
912715271 1:111979114-111979136 CATTGTCAGATGTGGGGTGAGGG + Intronic
915636542 1:157190833-157190855 TAGAGTCAGCAGTGGGAACAGGG + Intergenic
916794215 1:168150788-168150810 AAATGTCAGGTGTGTGAACAAGG - Intergenic
916839246 1:168583232-168583254 CAGTGTAATATGTGGGATGATGG + Intergenic
917806782 1:178620955-178620977 CAGTGGGAGATGTTGGATCATGG - Intergenic
920126864 1:203700398-203700420 CAGAGTCAGAGGAGAGAACAGGG - Intronic
920212488 1:204338459-204338481 CAGTCTCAAATGTGTGAAAAAGG + Intronic
920715438 1:208335982-208336004 CAGTATGAGAGGTGGGGACAGGG + Intergenic
922042808 1:221913619-221913641 CAGTGTGTGATATGGGAAGATGG - Intergenic
922953944 1:229583381-229583403 CAGTGTTCCATGTGGGAAGAAGG - Intergenic
923538166 1:234869105-234869127 AAGTGCCAGAAGTGGGAAGATGG - Intergenic
923851573 1:237801875-237801897 AAGTATCAGATGTGGAAACTAGG + Exonic
1063075555 10:2713033-2713055 CCCTGCCAGATGTGGTAACATGG - Intergenic
1063079071 10:2747897-2747919 CCATTTCAGATGTGAGAACAAGG + Intergenic
1063088625 10:2841887-2841909 CATTGACAGATGTGGGGACCTGG - Intergenic
1063553201 10:7052655-7052677 CAGTTTCAGATGTGGTATTAAGG - Intergenic
1064618689 10:17191979-17192001 CAGTGTCAGATGAGGCAAGGTGG + Intronic
1065086540 10:22184367-22184389 CAGTGTTAGAAGTGGCAATAAGG + Intergenic
1067297429 10:44982743-44982765 CAGTGTCCCATAAGGGAACAGGG - Intronic
1067381025 10:45773553-45773575 CAGTGTCAGGTGTAGGCACAAGG + Intronic
1067559144 10:47292584-47292606 CTGTGCCAGATGTGGGATCTTGG - Intergenic
1067888724 10:50114192-50114214 CAGTGTCAGGTGTAGGAACAAGG + Intronic
1068931058 10:62590754-62590776 CAGTGACAGTTGAGGGAACAAGG - Intronic
1069147827 10:64917749-64917771 CATTGCCAGATGTGGTAACTAGG + Intergenic
1070994446 10:80763725-80763747 GAGGGTCAGATGTTGGATCAGGG + Intergenic
1071312068 10:84352378-84352400 CAAGGTGAGGTGTGGGAACAGGG + Intronic
1071991725 10:91106091-91106113 CAGTGTCAGTTGCAGGGACATGG - Intergenic
1072065077 10:91860471-91860493 CAGTGTCACATCTGGGAACTTGG - Intronic
1074105128 10:110383465-110383487 CTGTGTCAGATGTGGGGACATGG + Intergenic
1075001248 10:118799786-118799808 AAGGGTCAGATGTCGGAAAAAGG - Intergenic
1075313602 10:121434342-121434364 TATTGTCAGATGTGGGAGGAGGG - Intergenic
1075678766 10:124317347-124317369 GAGGGTCAGAGGTGGAAACAGGG + Intergenic
1076079782 10:127568698-127568720 CTGAGACAGATGTTGGAACAAGG + Intergenic
1076126241 10:127976283-127976305 CAGTATCAAATTTGGAAACATGG - Intronic
1076221284 10:128734956-128734978 CAGGGTCAGAAGAGGGAGCACGG + Intergenic
1077436092 11:2539905-2539927 CAGGGTCAGATGTGAAAACAAGG - Intronic
1078914953 11:15770456-15770478 GAGTGTGAGATGTGGAAACCTGG - Intergenic
1079052566 11:17175016-17175038 CATTACCAGATGTGGCAACAAGG - Intronic
1079310219 11:19358740-19358762 CTGTGTAAGAGGTGGGAAGAGGG - Intronic
1079485667 11:20933703-20933725 CCCTGTCAGATGTGGATACAAGG - Intronic
1080239703 11:30112527-30112549 GAGTGTCAGATGTTGGCAAAGGG - Intergenic
1083325374 11:61870351-61870373 CCCTCTCAGATGTTGGAACAGGG - Intergenic
1084108458 11:66997019-66997041 CAGTCTCAGCTGTGGCAAGAGGG + Intergenic
1085317475 11:75554345-75554367 CAGGGCCAGATGGGGAAACACGG - Intergenic
1086053096 11:82617138-82617160 ATGTGTCAGATGAGTGAACATGG - Intergenic
1089175613 11:116546952-116546974 CAGAGGAAGATGTGGGAAAATGG + Intergenic
1090836830 11:130460102-130460124 ATGTGTCAGAGGTGGGAACTAGG - Intronic
1090947214 11:131441557-131441579 CAGTAACAGATGGAGGAACAAGG - Intronic
1091224570 11:133949850-133949872 CATTGTCAGGAGTGGGCACAGGG + Intronic
1091295395 11:134470550-134470572 CAGTGTGGGATGTTGGACCAGGG + Intergenic
1092527801 12:9319881-9319903 CACCCTCAGATGTGGTAACAAGG - Intergenic
1092539464 12:9411878-9411900 CACCCTCAGATGTGGTAACAAGG + Intergenic
1094027230 12:25971421-25971443 CAGTGCCAAAGGTGGGAACTTGG - Intronic
1094435368 12:30415204-30415226 TTTTGGCAGATGTGGGAACAAGG - Intergenic
1095900201 12:47320128-47320150 CAGCGTCAGATCTGGAAATAGGG + Intergenic
1098176426 12:67796833-67796855 CAGTCGCAAATGTGGGAAAAGGG - Intergenic
1098452457 12:70635346-70635368 CACTGTTAGATGTAGGAATATGG - Intronic
1099966514 12:89452166-89452188 CGGTCTCAGCTGTGGGAACTGGG + Intronic
1100767678 12:97885804-97885826 CAGAGTCAGGTTTGGGACCAAGG - Intergenic
1101047634 12:100826613-100826635 CAGTGTAAGATAAAGGAACAGGG - Intronic
1103682032 12:122701840-122701862 CTGAGGCAGATGTGGGAAGAAGG + Exonic
1103683780 12:122715301-122715323 CTGAGGCAGATGTGGGAAGAAGG + Exonic
1103980258 12:124732552-124732574 GAGGGTCACACGTGGGAACAAGG + Intergenic
1107731094 13:43349893-43349915 AAGTGACAGCTGTGGGGACAGGG - Intronic
1112059534 13:95723900-95723922 TTGTGACAGATGTGTGAACAGGG + Intronic
1114848088 14:26348246-26348268 TAGTGTGAGGTGTGGGATCATGG - Intergenic
1115653033 14:35416948-35416970 CAGAGTCAGGAGTGGGAAGAAGG + Intergenic
1116225100 14:42140326-42140348 CACTGTTAGAAGAGGGAACAGGG - Intergenic
1117379721 14:55149253-55149275 CAGGGTTCGATCTGGGAACAGGG + Intronic
1117582649 14:57168486-57168508 CTGGGTCAGATGTGGGTCCAAGG - Intergenic
1117589703 14:57254700-57254722 CAGTGTTAGATGAGGTCACAAGG + Intronic
1118049218 14:62008201-62008223 CAGGGGCAGATATGGGAAGAGGG - Intronic
1118720211 14:68588583-68588605 CAGGGTCAGTTCTGGGGACAGGG + Intronic
1121522692 14:94597332-94597354 GAGTCTCAGAAGTGGGAAAAGGG + Intronic
1121649274 14:95545179-95545201 CGGTGGCAGAGGTGGGAAGAAGG + Intergenic
1121898770 14:97673112-97673134 CAGTGTAGGATTTGGGAAAAGGG + Intergenic
1122322461 14:100863512-100863534 CTTTGTCAGATGTTGGAACTGGG - Intergenic
1122631724 14:103110310-103110332 CAGTGTCAGAGTTGGGGGCAGGG - Intronic
1122711578 14:103662509-103662531 CAGTGTCAGGGATGGCAACATGG - Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1124390396 15:29250507-29250529 CAGTCTGCGATGTGGGAAAACGG + Intronic
1127485346 15:59413174-59413196 CTGTGGGAGATGGGGGAACATGG + Intronic
1129979158 15:79850640-79850662 CAGTGTCAAATGTGGCAGAATGG + Intronic
1130074668 15:80678406-80678428 CAGTGGCAGATATGGGGGCAGGG - Intergenic
1131679536 15:94706907-94706929 TAATTTCAGAGGTGGGAACATGG - Intergenic
1132116949 15:99144314-99144336 CAGTGGCAGCTATGGGATCAGGG + Intronic
1133442323 16:5831174-5831196 CAGTGTTGGAGGTGGGAACCTGG + Intergenic
1133684726 16:8155264-8155286 CACTGTCAGAGGTGGGAGGAAGG - Intergenic
1135634469 16:24062274-24062296 CAGTGTCAGCTGGAGGGACAGGG + Intronic
1136471065 16:30480583-30480605 CAGTGTTACATGAGGGAGCAAGG + Intronic
1138967337 16:62100435-62100457 CAGGGTGAGATGTGGTAACATGG + Intergenic
1139397848 16:66654661-66654683 CAGTGGCAGAGCTGGGATCACGG - Intronic
1140112843 16:72018372-72018394 CAGTGTCAGATTTGGGGAATAGG + Intronic
1140275138 16:73502274-73502296 CAGTGTCAGATTGAGGACCATGG + Intergenic
1144428215 17:15165429-15165451 CAGTGTTAAATGTGGTCACATGG - Intergenic
1145779996 17:27556703-27556725 CAGAGTCAGAGGAGGGAACAGGG + Intronic
1151077955 17:71296037-71296059 CAGTGTCAGAGGTGGGGTCCTGG - Intergenic
1151440979 17:74128941-74128963 CAGTGTCAGAGCTGGGGAAATGG - Intergenic
1151883824 17:76911646-76911668 CAGTGACAGATGTGAGGCCAGGG + Intronic
1153071057 18:1105090-1105112 TAGTCTGAGATCTGGGAACAGGG + Intergenic
1153560343 18:6366421-6366443 CACTTTCAGATGTTGGAAGATGG - Intronic
1153773849 18:8435895-8435917 CAATGTCAGAAATGGCAACAAGG - Intergenic
1154981634 18:21507014-21507036 CAGGATGAGATGTGGGAAAAGGG - Intronic
1156270679 18:35527596-35527618 CAGTGACCGATCTGGGAACCAGG - Intergenic
1157172283 18:45418885-45418907 CAGTGTCAGAGGAGGGGAGAGGG + Intronic
1157627560 18:49063198-49063220 CTGTGTCAGGTGTGGGAAATTGG - Intronic
1157903581 18:51544760-51544782 CACTGTCAGAAGTGGAAAAATGG - Intergenic
1158315953 18:56211328-56211350 AACTGTCAGATGATGGAACAGGG - Intergenic
1159877335 18:73827297-73827319 TAATCTCAGCTGTGGGAACATGG + Intergenic
1161236950 19:3202928-3202950 CCGGGGCAGATGTGGGAAGATGG + Intronic
1161646508 19:5456467-5456489 CAGTGGTAGGTGTGGGAGCAGGG - Exonic
1161770887 19:6230150-6230172 CAGTGCCAGCTCTGGGACCAGGG - Intronic
1161931844 19:7345811-7345833 CTGTGGCAGGTGTGGGATCACGG - Intergenic
1163179663 19:15590239-15590261 AAGGGTCAGATGTGGGGTCAAGG - Intergenic
928713677 2:34035671-34035693 CAGGGACAGATGTGGACACAAGG + Intergenic
929687109 2:44044533-44044555 AAGTGTCTGATGTGAGAACAGGG + Intergenic
930011855 2:46943362-46943384 TAGTGTCAGAGTTGGGGACACGG + Intronic
930019965 2:46995530-46995552 CTGTGACAGATTTGAGAACATGG + Intronic
932735223 2:74249696-74249718 CAATGTCAGCTGTGTGAACTGGG + Intronic
933498056 2:83076329-83076351 CAGTGAAATATGTGGGAAAATGG - Intergenic
933878342 2:86643035-86643057 CACTGTCAGAAGAGGGAAAAAGG - Intronic
935632291 2:105221990-105222012 CATTTTCAGATGAGGGACCAAGG + Intergenic
936732828 2:115404921-115404943 CAGTGCCACATTGGGGAACATGG + Intronic
936839738 2:116754789-116754811 CAGTGACAGTTGTGGGGGCATGG - Intergenic
939575723 2:143892722-143892744 CAGTGTCATCAGTGGGAAAAGGG + Intergenic
940051064 2:149465277-149465299 CAGGGTCAGACATGGGAAAAGGG + Intronic
941249027 2:163138738-163138760 CAGTGTCAGATGTGCATAAAAGG + Intergenic
941864131 2:170316110-170316132 CACTGTGAGATATGGGAATATGG - Intronic
941992184 2:171568267-171568289 CACTGTCACCTGTGGTAACATGG - Intergenic
942392933 2:175514995-175515017 AAGAGTCAGATGTGAGAATATGG + Intergenic
942523191 2:176825977-176825999 CAGTTTTAGATGTGGGAAGGTGG + Intergenic
947589202 2:231375565-231375587 GTGTGTCAGATGTGGAGACATGG + Intergenic
948093393 2:235314541-235314563 CAGTGTCATTTGTGGGCTCATGG + Intergenic
948172806 2:235919106-235919128 CAGGGTCAGCTGTGGGAAAGAGG + Intronic
1169655565 20:7918921-7918943 CAGTGTCTGCTTTGGGAGCAGGG - Intronic
1169665025 20:8023633-8023655 AAGTGCCAGATGTGGGTGCAAGG - Intergenic
1170797358 20:19560525-19560547 CATTGTCAGAAGTGGGCAGAAGG + Intronic
1172539170 20:35698045-35698067 CAGAAACAGATGTCGGAACAAGG - Intronic
1172576879 20:36016403-36016425 CAATGTAAGATGTGGGAAACTGG + Intronic
1172862866 20:38069515-38069537 CAAAGTCAGATGTGGGAAGGAGG + Intronic
1173003750 20:39124087-39124109 CAGTCTCAGGTGTGGTCACATGG + Intergenic
1173086750 20:39926965-39926987 AAGTGGCAGATGTGGGAGAAGGG + Intergenic
1173351902 20:42253161-42253183 CAGAGTCAGGTGTGGCCACAGGG + Intronic
1174291899 20:49514676-49514698 CAGTGTCAGTAATAGGAACAGGG + Intronic
1175524058 20:59621443-59621465 CAGTGTCAGGGCTGGGAGCATGG + Intronic
1175530277 20:59670255-59670277 CTGTTTCAGATGTGGGCACTGGG + Intronic
1175616826 20:60406995-60407017 CAATGTCAGTTGTGGCAACATGG + Intergenic
1176686258 21:9850929-9850951 CAGAGTCAGAAATGGGACCAAGG - Intergenic
1178966139 21:37120128-37120150 TACTGTGAGAAGTGGGAACATGG + Intronic
1178979047 21:37245488-37245510 CAGTTTCAAATGTGGGCTCACGG - Intronic
1179423032 21:41251225-41251247 CTGAGTCACATGTGGTAACAGGG + Intronic
1179882049 21:44296995-44297017 CAGTGTCTGATGTGGCACCCGGG + Intronic
1180166083 21:46030226-46030248 CACTGTCACCTGAGGGAACATGG + Intergenic
1183457691 22:37931717-37931739 CAGCCTCATATTTGGGAACATGG - Intronic
1184032853 22:41905049-41905071 CAATGCCAGATGTGGGAGCTGGG - Intronic
949515458 3:4803234-4803256 CAGTGTCAGAGGTGGGGCCTGGG - Intronic
950833720 3:15900036-15900058 CAGTGGCTGAGGTGGGAAGATGG - Intergenic
950865763 3:16187978-16188000 CAGTGTCAGATGTGGGAACAAGG + Intronic
951246090 3:20343333-20343355 AAATTTCAGATGTGTGAACATGG + Intergenic
953193988 3:40714868-40714890 CTGAGTCAGATGAGGGAAAAAGG + Intergenic
953552832 3:43917703-43917725 CAGTGGCAGGTGTGGGCTCATGG + Intergenic
954421843 3:50423025-50423047 CAGAGACAGATGGGGGAACAGGG - Intronic
954677603 3:52324404-52324426 CAGTGGCAGAGGGGAGAACAGGG + Intronic
954744458 3:52779218-52779240 CAGTGGCATATCTGGGAAAAGGG - Intronic
955803414 3:62709077-62709099 AACTGTCAGATGTTGGGACAGGG - Intronic
955877680 3:63510493-63510515 ACGTGCCAGTTGTGGGAACAAGG + Intronic
957997280 3:87706482-87706504 GAGTGGGAGATGTGGGAAGATGG - Intergenic
960599011 3:119436818-119436840 AAGTGGCAGAAGTTGGAACATGG - Exonic
960989757 3:123302876-123302898 CAGTGTCTGCACTGGGAACAAGG - Intronic
961357242 3:126346784-126346806 CAGTGGGGGATGTGGGAACCCGG + Intronic
963697868 3:148584677-148584699 CATTGTCAGGTGTGGGGACCAGG - Intergenic
967107013 3:186262228-186262250 CAGTGAGAAATGTGGGACCAGGG - Intronic
967494804 3:190130741-190130763 CAGAGACAGATGTAGGAAGAGGG - Intergenic
968820697 4:2848571-2848593 CAGAGTCAGAGGTGGGAGAATGG - Intronic
969152840 4:5185041-5185063 CAGCGTCAGACGTGAGGACACGG + Intronic
971391968 4:26194478-26194500 CATTGTCAGATGAGGAAACTAGG + Intronic
972043118 4:34629142-34629164 CAATGTCACCTGTGGGAATATGG - Intergenic
972370001 4:38414325-38414347 CAGTGTCGGTCCTGGGAACAAGG + Intergenic
975260606 4:72293221-72293243 CAGTGTGAGCTGTGAAAACAAGG + Intronic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
979319969 4:119311729-119311751 GAGTGTCAGAGGTGAGATCATGG - Intergenic
979988877 4:127350409-127350431 CTGTGTCTTTTGTGGGAACATGG + Intergenic
980124171 4:128757721-128757743 CTGTGTAAGATTTGGGAAAAGGG - Intergenic
980349707 4:131669405-131669427 CAGTGTCAGAAATGGGACCAAGG - Intergenic
980371518 4:131880276-131880298 CTGTGCCAGATTTGGTAACAGGG - Intergenic
980775662 4:137432680-137432702 CAGTTTCACATTTGGGAACTCGG - Intergenic
981245595 4:142533849-142533871 CAGTGCAAGTTCTGGGAACATGG + Intronic
982782729 4:159507889-159507911 CAGTATTAAATGTGGTAACATGG + Intergenic
983100910 4:163624399-163624421 CAGTCACTGATGTGGCAACAGGG - Intronic
984635687 4:182106798-182106820 CAGTATCAGCTGTGGGAAACTGG + Intergenic
986626598 5:9728756-9728778 TAGTGGCAGATCTGGGAACATGG + Intergenic
987520856 5:18981549-18981571 TAATGTCATTTGTGGGAACATGG - Intergenic
989290234 5:39755645-39755667 CAGTTTCTGATGTCAGAACATGG + Intergenic
990369407 5:55102090-55102112 CTGTGGCAGGTGTGGGAACATGG - Intergenic
992623022 5:78611882-78611904 CTGTATCACATGTGGGAAAATGG - Intronic
995315014 5:110759814-110759836 CAGGGTCAGAAGTAGGAAGATGG + Intronic
997702433 5:135912145-135912167 CTGCCTCAGAGGTGGGAACAAGG - Intergenic
999063406 5:148659254-148659276 CTGTGTCATATATGGGCACATGG + Intronic
1000378412 5:160606042-160606064 CAGTTTCATTTGTTGGAACATGG + Intronic
1002309827 5:178307590-178307612 CAGGGTCTGATGTGGGCAGAGGG - Intronic
1002380942 5:178829480-178829502 GAGGGGCAGATGGGGGAACAAGG - Intergenic
1005985653 6:30872904-30872926 CAGTGTCAGTGGAGGTAACATGG - Intergenic
1006623033 6:35380312-35380334 CACTGTGAGATGTGGAACCACGG - Intronic
1007071667 6:39042633-39042655 TAGTGTCAGAAGTGGGGAGAAGG - Intergenic
1007596776 6:43055816-43055838 CAGTACCAGATGTGGAACCATGG + Intronic
1009502076 6:64426361-64426383 CTGTGTCAGTTGTGGGAACATGG + Intronic
1010757803 6:79686958-79686980 CTGTGTCTGATGTGGGGTCAGGG + Intronic
1011093477 6:83633382-83633404 CAGTGTCAGCTGTGGTAGTATGG + Intronic
1011826053 6:91306947-91306969 CATCTTCAGTTGTGGGAACAGGG + Intergenic
1014376872 6:120687034-120687056 CAGTGTCCTTTGTGGCAACATGG + Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1016375115 6:143412378-143412400 CAGAGTCAGAAGTGGCAAAATGG - Intergenic
1016645972 6:146408727-146408749 CCGTGTGAGATGTGTGAAGAAGG + Intronic
1017870242 6:158480812-158480834 CATTGTCTGATGTGGGATCCTGG + Intronic
1020013499 7:4818495-4818517 CAGGGTCACATCTGGGAACCAGG + Intronic
1020015395 7:4828658-4828680 CAGTTTCAGGTGTGGGATCACGG + Intronic
1020118991 7:5492273-5492295 CAGTGGCAGATGTGGGGATGTGG + Intronic
1020438052 7:8187134-8187156 CACTGTATGATGTGTGAACAAGG - Intronic
1022333514 7:29401630-29401652 CACTGACAGATATGGGAACGTGG + Intronic
1023613528 7:41995276-41995298 CCGTCATAGATGTGGGAACATGG + Intronic
1024037123 7:45516633-45516655 CAGTGTCAGAAGTGGTAGGAAGG + Intergenic
1024867297 7:53918786-53918808 CTGTGTCACCTGTGGGATCAGGG - Intergenic
1028224855 7:88238267-88238289 CATTTTCAGATGTGGAACCAAGG + Intergenic
1030063746 7:105643323-105643345 CAGTGTCAGGGGTGGCATCAGGG + Intronic
1030821775 7:114101493-114101515 CAGTGTCAGAAAAGGAAACAAGG + Intronic
1032571261 7:133001325-133001347 CAGTGTTAGATGTGAGAGAAAGG - Intronic
1033497530 7:141914537-141914559 CAATATCAGAAATGGGAACAAGG + Intronic
1034408721 7:150924717-150924739 CCGAGTCAGAGGTGAGAACAAGG + Intergenic
1035874723 8:3175684-3175706 GAGCTTCAGACGTGGGAACATGG + Intronic
1038219977 8:25598133-25598155 CAGTTTTAGATTTTGGAACATGG + Intergenic
1039295535 8:36147865-36147887 CCATGTCAGATGTGACAACATGG - Intergenic
1039309897 8:36305931-36305953 CATTGTCAGCTGTGGCATCAGGG + Intergenic
1040676781 8:49759505-49759527 CAGTGTCAGTTTTGAGAAAAAGG - Intergenic
1041014171 8:53574009-53574031 CAGTGTCTGACTGGGGAACATGG + Intergenic
1042863554 8:73336944-73336966 CAGGACCAGATGTGGGAAGATGG + Intergenic
1043912451 8:85878623-85878645 CAGTGTGAGAAGTGCTAACATGG - Intergenic
1044237115 8:89843700-89843722 CCGTGTCTTTTGTGGGAACATGG - Intergenic
1049379926 8:142306988-142307010 CAGTGTTAGAAGTTGGAACTGGG - Intronic
1049468550 8:142764796-142764818 CAGTGGCAGATGGGGCAGCAGGG - Intronic
1050259555 9:3827299-3827321 AAGTGCCAGATGTGAGAACTGGG - Intronic
1057794356 9:98144934-98144956 GAGGGTGAGATGTGGGACCAGGG + Intronic
1057797493 9:98169336-98169358 CAGTGTCAGATGTGGGGAGGAGG - Intronic
1058358986 9:104119765-104119787 CAGTGTCAGACGATGGAAGATGG + Intronic
1058859321 9:109099262-109099284 CAGTATCAGAAGTGGGGACTGGG + Intronic
1059848100 9:118303895-118303917 CAGAGTCATATCTGGGGACAAGG - Intergenic
1060280262 9:122211051-122211073 CAGTTTTAGATGTTGGAATATGG - Intronic
1060799424 9:126534318-126534340 CAGTGACAGAAGTAGGAAGAAGG + Intergenic
1061563605 9:131422565-131422587 CAGTGTCAGATGCCTGACCAGGG - Intronic
1061596690 9:131635039-131635061 CAGAGCCAGATGAGGGGACAGGG + Intronic
1061793437 9:133070721-133070743 CACTGGCAAATGAGGGAACAAGG - Intronic
1186800496 X:13087792-13087814 CAGTATGAGATAGGGGAACATGG + Intergenic
1187081290 X:15991063-15991085 AAGAGTGAGATGTGGGGACAGGG - Intergenic
1190251319 X:48728540-48728562 CAGAGACATATGTGGGCACATGG + Intergenic
1190757494 X:53413544-53413566 CAGTGTGAAATGTGGCAGCAGGG - Intronic
1191718278 X:64207699-64207721 CAGTCTCAGTTGTGGAAGCAGGG + Intergenic
1192463431 X:71337535-71337557 CAGTGAAAGCAGTGGGAACAGGG - Intergenic
1192478008 X:71460277-71460299 AAGTGTTATATGTGGCAACAGGG + Intronic
1196292111 X:113954990-113955012 TAGTGCCAGATCTGGGAGCAGGG + Intergenic
1196551090 X:117026090-117026112 CAGTGTCAGATGTATAAAGAAGG - Intergenic
1198122272 X:133605984-133606006 CAGAGGCAGATGTGGAAGCAAGG - Intronic
1199879711 X:151964275-151964297 CAATGTCAGCTCTGGAAACAGGG - Intronic
1200673887 Y:6127214-6127236 CAGTAGCAGCAGTGGGAACATGG + Intergenic
1201019646 Y:9642086-9642108 AAGTTTAAGATGTTGGAACAGGG - Intergenic
1201596738 Y:15678894-15678916 CAGTATGAGATGTTGGAAAAGGG + Intergenic